Содержание

Защитные сооружения гражданской обороны

Один из наиболее надежных способов защиты населения от воздействия АХОВ при авариях на химически опасных объектах и от радиоактивных веществ при неполадках на АЭС, во время стихийных бедствий: бурь, ураганов, смерчей, и, конечно, в случае применения оружия обычных видов и современных средств массового поражения — это укрытие в защитных сооружениях. К таким сооружениям относят убежища и противорадиационные укрытия (ПРУ). Кроме того, для защиты людей могут применяться и простейшие укрытия. Защитные сооружения по месту расположения могут быть встроенными, расположенными в подвалах и цокольных этажах зданий и сооружений, и отдельно стоящими, сооружаемыми вне зданий и сооружений. Размещают их возможно ближе к местам работы или проживания людей.

УБЕЖИЩА представляют собой сооружения, обеспечивающие наиболее надежную защиту укрываемых в них людей от воздействия всех поражающих факторов ядерного взрыва, отравляющих веществ и бактериальных средств, высоких температур и вредных газов в зонах пожаров, а также от обвалов и обломков разрушенных зданий при взрывах.

 Характеризуются они наличием прочных стен, перекрытий  и

дверей, наличием герметических конструкций и фильтровентиляционных устройств. Все это создает благоприятные условия для нахождения в них людей в течение нескольких суток. Не менее надежными делаются входы и выходы, а на случай их завала — аварийные выходы (лазы). Длительное пребывание людей возможно благодаря надежному электропитанию (дизельная электростанция), санитарно-техническим устройствам (водопровод, канализация, отопление), радио- и телефонной связи, а также запасам воды, продовольствия и медикаментов. Во всех убежищах предусматривается два режима вентиляции: чистой — наружный воздух очищается от пыли; фильтровентиляции — воздух пропускается через фильтры-поглотители, где он очищается от всех вредных примесей, веществ и пыли. Если убежище расположено в пожароопасном месте (нефтеперерабатывающее предприятие) или в районе возможной загазованности аварийно химически опасными веществами, предусматривается и третий режим — изоляции и регенерации (т.

е. восстановления газового состава, как это делается на подводных лодках). Система водоснабжения питает людей водой для питья и гигиенических нужд от наружной водопроводной сети. На случай выхода водопровода из строя предусмотрен аварийный запас или самостоятельный источник получения воды (артезианская скважина). В аварийном запасе — только питьевая вода (из расчет 3 л в сутки на человека). При отсутствии стационарных баков устанавливаю переносные емкости (бочки, бидоны, ведра). Каждое защитное сооружение имеет систему канализации, позволяющую отводить фекальные воды. Санузел размещают в помещении, изолированном перегородками от отсеков убежища, и обязательно устраивают вытяжку. Система отопления — радиаторы или гладкие трубы, проложенные вдоль стен. Работает она от отопительной сети здания, под которым расположено. Электроснабжение необходимо для питания электродвигателей системы воздухоснабжения, артезианских скважин, перекачки фекальных вод, освещения.
Осуществляется оно от городской (объектовой) электросети, в аварийных случаях — от дизельной электростанции, находящейся в одном из помещений убежища. В сооружениях без автономной электростанции предусматривают аккумуляторы, электрические фонари. Запас продуктов питания создается из расчета не менее чем надвое суток для каждого укрываемого.

Противорадиационные укрытия (ПРУ).

Используются они главным образом для защиты от радиоактивного заражения населения сельской местности и небольших городов. Они должны обеспечить необходимость ослабление радиоактивных излучений, защитить при авариях на химически опасных объектах, сохранить жизнь людям при некоторых стихийных бедствиям бурях, ураганах, смерчах, тайфунах. Поэтому располагать их надо вблизи мест проживания (работы) большинства укрываемых.

В крупных ПРУ устраивается два входа (выхода), в малых — до 50 чел — допускается один. Во входах устанавливаются обычные двери, но обязательно уплотняемы в местах примыкания полотна к дверным коробкам. В ПРУ предусматривается естественная вентиляция или вентиляция с механическим побуждением. Естественная осуществляется через воздухозаборные вытяжные шахты. Отверстия для подачи приточного воздуха располагаются в нижней зоне помещений, вытяжные — в верхней зоне. Отопление укрытий устраивают общим с отопительной системой зданий, в которых они оборудованы. Водоснабжение — от водопроводной сети. Если водопровод отсутствует, усиливают бачки для питьевой воды из расчета 2 л в сутки на человека, В укрытиях, расположенных в зданиях с канализацией, устанавливают нормальные туалеты с отводом сточных вод в наружную канализационную сеть. А где такой возможности нет, для приема нечистот используют плотно закрываемую выносную тару. Освещение — от электрической сети, а аварийное — от аккумуляторных батарей, различного типа фонариков.

Простейшие укрытия типа щели, траншеи, окопа, блиндажа, землянки прошли большой исторический путь, но мало чем изменились по существу. Все эти сооружения максимально просты, возводятся с минимальными затратами времени и материалов. Щель может быть открытой и перекрытой. Она представляет собой ров глубиной 1,8—2 м, шириной по верху 1 — 1,2 м, по низу — 0,8 м. Обычно щель строится на 10—40 человек. Перекрытие щели делают из бревен, брусьев, железобетонных плит или балок. Поверху укладывают слой мятой глины или другого гидроизоляционной материала (рубероида, толя, пергамина, мягкого железа) и все это засыпают слоем грунта 0,7-0,8 м, прикрывая затем дерном. Следует иметь в виду, что щели не обеспечивают защиту от отравляющих веществ и бактериальных средств, и в случае применения  этого

оружия нужно пользоваться средствами индивидуальной защиты (СИЗ). Строят щели вне зоны возможных завалов (на расстоянии от наземных зданий, равном половине высоты здания, плюс 3 м), а при наличии свободной территории и дальше. Защитные свойства щели усиливаются путем перекрытия ее бревнами, брусьями или железобетонными плитами.

Простейшие [Одноклеточные] — животное, описание, характеристика, строение, питание, дыхание, размножение, где обитает, виды, фото, вики — WikiWhat

История открытия

Как известно, в 1675 г. т. е. более трёхсот лет назад, А. Левенгук открыл «анималькулов» (зверушек), которых впоследствии назвали инфузориями. С 1820 г. установилось название Protozoa, что в перево­де с греческого означает «простейшие животные». Зоолог К. Зибольд посчитал их особым типом животного царства и выделил два класса: инфузорий и корненожек. Он же определил, что простота их органи­зации соответствует одной клетке. С тех пор одноклеточность про­стейших стала общепризнанной, а название «одноклеточные» и «про­стейшие» стали синонимами.

По уровню организации все живые организмы классифицируются на две группы. Привычное для нас деление на одноклеточных и мно­гоклеточных потребовало уточнения, после того как при изучении строения организмов был применён электронный микроскоп и появи­лись новые методы исследования. Возникли вопросы об основных различиях, определяющих уровни развития, а также о планах строе­ния. Поэтому необходимо рассмотреть организацию простейших — парафилетической группы, объединяющей представителей органического мира, относимых ранее к растениям, животным и грибам, но имеющих свои специфиче­ские особенности.

Происхождение

Самозарождение

Природа простейших долгое время оставалась предметом спора. Одни учёные рассматривали их как живых молекул, или простые ком­плексы таких молекул, которые способны самозарождаться, т. е. воз­никать сами по себе. Этих воззрений придерживались немногие учение, тем более что блестящие опыты Л. Спаланцани в XVIII в. Л. Пастера в XIX в. опровергли идею самозарождения.

Целлюляризация

Другие учёные считали простейших весьма сложно организованными существами, которых можно структурно сравнить с высокоорганизованными жи­вотными. Основание для этого они видели в том, что в организме мно­гоклеточных есть структуры, не имеющие разделения на клетки, на­пример синцитии. Исходя из подобных воззрений, зоолог Й. Хаджи в 50-60-е годы XX в. выдвинул даже теорию происхождения многокле­точных животных путём целлюляризации. Обнаружив сходство инфу­зорий с самыми примитивными ресничными червями, так называемы­ми бескишечными, Хаджи предположил, что при обособлении частей тела инфузории, содержащих органоиды, и образовании между ними перегородок возникает многоклеточный организм. Следовательно, по своей природе инфузория сравнима с целым организмом низших мно­гоклеточных. Однако после электронно-микроскопических исследова­ний было доказано, что теория целлюляризации опирается только на внешние аналогии и конвергентные сходства.

Клеточная теория Т. Шванна

С позиций клеточной теории, разработанной М. Шлейденом и Т. Шванном, простейшие представляют собой одноклеточные орга­низмы. По мнению современных учёных, придерживающихся этих воззрений, простейшие — это клетки, которые функционально являются организмами. Однако функции не могут существовать отдельно от определённых структур. Таким образом, современное определение простейших как микроскопических одноклеточных животных, пред­ставляющих собой физиологически самостоятельные организмы, не соответствует нынешнему уровню знаний. Удовлетворительное опре­деление простейших может быть дано после ответов на следующие вопросы: являются ли простейшие только одноклеточными организ­мами? Всегда ли их размеры микроскопически малы? Являются ли они исключительно животными? Являются ли они организмами толь­ко в физиологическом отношении?

Размеры простейших варьируют в той же степени, что и размеры многоклеточных. В среднем они колеблются от 5 до 250 мкм. Наибо­лее мелки внутриклеточные паразиты, например лейшмании (1-4 мкм). Но уже инфузория-туфелька значительно крупнее — 150-250 мкм, амёба протей — 600 мкм, а современные глубоководные радиолярии име­ют диаметр тела 2,5 см. В современную систему простейших входят миксомицеты — настоящие гиганты среди протистов. Длина плазмодия одного из них доходит до 1,2 м. Короче говоря, различия в размерах простейших равняются 106.

Раньше считалось, что все про­стейшие — микроскопические существа. Сегодня среди них обнаружены и макроскопичес­кие виды. Размеры простейших колеблются от 1 мк (1 мк = 10-3 мм) до 5 см и более, но в среднем от 5 до 250 мк. Самые мелкие среди них — внут­риклеточные паразиты, например некоторые споровики и жгутико­носцы. Самые крупные предста­вители — колониальные радио­лярии, размеры которых могут достигать 25 см.

Подцарство Одно­клеточные (Простейшие) объединяет животных, тело которых состоит из одной клетки. Она выполняет функции самостоятельного организма. Клетка простейшего состоит из цитоплазмы, органоидов, одного или нескольких ядер. В ней происходят обмен ве­ществ с внешней средой, процессы размножения в развития.

Многие одноклеточные обладают специальными органоидами (движения, питания, выделения), возникшими как результат приспособления к среде обитания.

Клетка — это самовоспроизводящееся образование, отделённое от своего окружения плазматической мембраной, способ­ствующей регуляции обмена между внутренней и внешней средой.

Среда обитания

Простейшие животные — процветающая и разнообраз­ная группа (около 70 000 видов) — обитатели водоёмов и влажной почвы. Преимущественно они входят в состав зоопланктона — совокупность мельчайших животных, обитающих в морских и пресноводных водоёмах. На суше они встречаются тоже в водной среде — в почвенной капельной воде, а также в жидкой среде внутри много­клеточных животных и растений. Хотя почвенные про­стейшие животные могут существенно влиять на коли­чество бактерий, все же их значение несравненно меньше, чем у простейших в пресных и морских водоёмах.

Жизнедеятельность

см. Питание простейших

Многие простейшие животные так же мелки и просто устроены, как и некоторые клетки крупных животных. Но они отличаются от них тем, что способны жить само­стоятельно. Одноклеточные животные представляют собой слаженный организм, осуществляющий питание, дыхание, выделение, размножение, рост, развитие и обмен веществ. У него в протоплазме существует как бы разделение труда: каждая из её обособленных, более мелких образований выполняет свою особую задачу.

Например, ядро регулирует жизнедеятельность всего одно­клеточного организма и воспроизводит само себя, благодаря чему образуются новые дочерние организмы; в пищеварительной вакуоли происходит переваривание пищи; сократительная ваку­оль удаляет избыток воды и растворенные в ней вредные для организма вещества.

При неблагоприятных условиях многие простейшие перестают питаться, теряют органы движения, покрываются толстой оболочкой и образуют цисту. При наступлении благоприятных условий однокле­точные принимают прежний облик.

Классификация

Согласно названию Protozoa, в это подцарство должны входить только животные. Но в современной системе простейших содержатся зелёные жгутиконосцы (ботаники считают их водорослями), миксомицеты и плазмодиофориды (по мнению микологов, это грибы) и т. д. В связи с этим древние простейшие скорее всего могут рассматривать­ся в качестве исходной группы, давшей начало и грибам, и растениям, и животным. Поэтому в настоящее время должно считаться признанным выделение особого царства протистов и противопоставление его царствам растений и животных. Выделение царства протистов при­надлежит знаменитому зоологу и эволюционисту Э. Геккелю (1866). Protozoa же могут быть выделены в системе протистов в качестве подцарства.

Одноклеточные прошли длительный путь эволюции, в ходе которой возникло их огромное разнообразие. В зависимости от сложности строения и спо­собов передвижения выделяют несколько типов простейших. Материал с сайта http://wikiwhat.ru

Значение и роль

Со времён Линнея и до наших дней простейшие привлекают вни­мание учёных по разным причинам. Возникла даже специальная наука — протозоология.

Модель клетки

Простейшие представляют особый уровень развития живого мира поэтому их изучение имеет общебиологическое значение. В настоящее время простейшие исполь­зуются как модель эукариотной клетки для исследований в области молекулярной биологии, генетики, радиобиологии и других наук.

Роль в биосфере

Простейшие играют важную роль в биосфере, являясь необхо­димым звеном в круговороте веществ и потоке энергии. Простейшие животные — очень важные потребители бактерий и одноклеточных водорослей, а также животных, в основном одноклеточных. По объёму потребляемого ор­ганического вещества они занимают третье место вслед за бактериями и грибами. Они образуют начальные звенья в сетях питания после растительных организмов — первич­ных продуцентов органических веществ.

Возбудители заболеваний

Одноклеточные являются возбудителями заболеваний человека и домашних жи­вотных.

Вопросы к этой статье:
  • Расскажите о разнообразии простейших.

  • Кто из представителей про­стейших имеет наиболее сложное строение?

  • Каково значение простейших в природе и жизни человека?

  • В чём заключается средооб­разующая роль простейших?

Ароматические углеводороды — Что такое Ароматические углеводороды?

Ароматические углеводороды (арены) – это углеводороды, молекулы которых содержат одно или несколько бензольных колец.

Ароматические углеводороды (арены) — класс углеводородов, содержащих бензольные ядра, которые могут быть конденсированными и иметь насыщенные боковые цепи. 

К наиболее важным аренам относятся бензол (С6Н6) и его гомологи.

Это углеводороды, молекулы которых содержат 1 или несколько бензольных колец, и другие углеводородные группы (алифатические, нафтеновые, полициклические).

Простейшим представителем ароматических углеводородов является бензол, молекулярная формула которого С6Н6.

Установлено, что все атомы углерода в молекуле бензола лежат в одной плоскости, образуя правильный 6-угольник .

Каждый атом углерода связан с одним атомом водорода.

Длины всех связей углерод-углерод одинаковы и составляют 0,139 нм.

Для передачи строение молекулы бензола используют формулы Кекуле, которые предложил в 1865 г. немецкий химик Август Кекуле.

Важными аренами являются и гомологи бензола (толуол С6Н5СНз, ксилолы С6Н4(СНз)2, дурол, мезитилен, этилбензол), кумол, нафталин C10H8, антрацен С14Н

10 и их производные.

Ароматические углеводороды — исходное сырье для промышленного получения кетонов, альдегидов и кислот ароматического ряда, и других веществ.

Исторически название «ароматические углеводороды» сложилось потому, что многие производные бензола, которые первыми были выделены из природных источников, обладали приятным запахом.

В настоящее время под понятием «ароматичность» подразумевают, прежде всего, особый характер реакционной способности веществ, обусловленный, в свою очередь, особенностями строения молекул этих соединений.

В чем же состоят эти особенности?

В соответствии с молекулярной формулой С6Н6 бензол является ненасыщенным соединением, и можно ожидать, что для него были бы характерны типичные для алкенов реакции присоединения.

Однако в условиях, в которых алкены быстро вступают в реакции присоединения, бензол не реагирует или реагирует медленно.

Бензол не дает и характерных качественных реакций, свойственных непредельным углеводородам: он не обесцвечивает бромную воду и водный раствор перманганата калия.

Такой характер реакционной способности объясняется наличием в ароматическом кольце сопряженной системы — единого «пи»-электронного облака.

Одноклеточные животные, или Простейшие (общее описание) | Биология. Реферат, доклад, сообщение, краткое содержание, лекция, шпаргалка, конспект, ГДЗ, тест

Раздел:

Протозоология

Изучение животного мира вы начинаете с простейших — одноклеточных организмов. Они встречаются в любой влажной среде: в пресных водоемах, соленых морях, в почве, в организмах других животных и растений. Хотя люди и живут в окружении одноклеточных, но увидели их сравнительно недавно, лишь в конце XVII века. Первым, кто заглянул в микромир живых существ, был голландский натуралист Э. Левенгук.

Однако настоящий научный интерес к этим животным возник в XIX веке, когда ученые поняли: «единицей» строения живого является клетка. Оказалось, что клетки — это не только «кирпичики» многоклеточного организма. Выяснилось, что значительную часть населения микромира составляют одно­клеточные существа, живущие самостоятельно благодаря деятельности лишь одной клетки.

В таких клетках-организмах протекают все процессы жизнедеятельности, присущие животным клеткам. Газообмен у всех простейших происходит путем диффузии газов, растворенных в воде, через плазматическую мембра­ну: молекулы кислорода поступают в клетку, а молекулы углекислого газа удаляются. Так же в нее поступает и вода. Способом питания простейших является Эндоцитоз, а одним из способов выделения — Экзоцитоз. Есть у них и известные вам органеллы.

Но строение простейших имеет и некоторые особенности, определяющие их приспособленность к самостоятельной жизни. Это органеллы, с помощью которых они двигаются, добывают пищу, выделяют вредные вещества харак­терным для них способом. Материал с сайта http://worldofschool.ru

Сегодня среди простейших насчитывается около 70 тыс. видов животных, объединенных в несколько типов. На страницах данного сайта Вы найдете информацию о том, какие особенности строения обусловливают их жизнеспособность как отдельных организмов, как проте­кают процессы их жизнедеятельности, как размножаются простейшие, какую роль они играют в природе и жизни человека.

На этой странице материал по темам:
  • Черви простейшие одноклеточные животные бесчерепные

  • Роль одноклеточных животных в природе и жизни человека

  • Реферат по биологии на тему одноклеточные животные

  • Зоология одноклеточные животные литература

  • Сообщение на тему вредных и полезных одноклеточных

Вопросы по этому материалу:
  • Как происходит газообмен у саркодовых?

  • Почему простейшие могут жить лишь во влажной среде?

Здоровый образ жизни — Больница КНЦ СО РАН


Здоровый образ жизни — это активное участие в трудовой, общественной, семейно-бытовой, досуговой формах жизнедеятельности человека. К сожалению, многие люди не соблюдают самых простейших, обоснованных наукой норм здорового образа жизни. Одни становятся жертвами малоподвижности, вызывающей преждевременное старение, другие излишествуют в еде с почти неизбежным в этих случаях развитием ожирения, склероза сосудов, третьи не умеют отдыхать, отвлекаться от производственных и бытовых забот, вечно беспокойны, нервны, страдают бессонницей, что в конечном итоге приводит к многочисленным заболеваниям внутренних органов.

Существует три вида здоровья: физическое, психическое и нравственное (социальное).

Физическое здоровье ― это естественное состояние организма, обусловленное нормальным функционированием всех его органов и систем. Если хорошо работают все органы и системы, то и весь организм человека (система саморегулирующаяся) правильно функционирует и развивается.

Психическое здоровье зависит от состояния головного мозга, оно характеризуется уровнем и качеством мышления, развитием внимания и памяти, степенью эмоциональной устойчивости, развитием волевых качеств.

Нравственное здоровье определяется теми моральными принципами, которые являются основой социальной жизни человека, т.е. жизни в определенном человеческом обществе. Отличительными признаками нравственного здоровья человека являются, прежде всего, сознательное отношение к труду, овладение сокровищами культуры, активное неприятие нравов и привычек, противоречащих нормальному образу жизни.

Здоровый образ жизни является предпосылкой для развития разных сторон жизнедеятельности человека, достижения им активного долголетия и полноценного выполнения социальных функций. Актуальность здорового образа жизни вызвана возрастанием и изменением характера нагрузок на организм человека в связи с усложнением общественной жизни, увеличением рисков техногенного, экологического, психологического, политического и военного характера, провоцирующих негативные сдвиги в состоянии здоровья.

Здоровый образ жизни включает в себя следующие основные элементы: «плодотворный труд, рациональный режим труда и отдыха, искоренение вредных привычек, оптимальный двигательный режим, личную гигиену, закаливание, рациональное питание и т. п.».

Плодотворный труд ― важный элемент здорового образа жизни. На здоровье человека оказывают влияние биологические и социальные факторы, главным из которых является труд. Рациональный режим труда и отдыха ― необходимый элемент здорового образа жизни. При правильном и строго соблюдаемом режиме вырабатывается четкий и необходимый ритм функционирования организма, что создает оптимальные условия для работы и отдыха и тем самым способствует укреплению здоровья, улучшению работоспособности и повышению производительности труда.

Следующим звеном здорового образа жизни является искоренение вредных привычек (курение, алкоголь, наркотики). Эти нарушители здоровья являются причиной многих заболеваний, резко сокращают продолжительность жизни, снижают работоспособность, пагубно отражаются на здоровье подрастающего поколения и на здоровье будущих детей.

Следующей составляющей здорового образа жизни является рациональное питание. Когда о нем идет речь, следует помнить о двух основных законах, нарушение которых опасно для здоровья.

Первый закон ― равновесие получаемой и расходуемой энергии. Если организм получает энергии больше, чем расходует, то есть если мы получаем пищи больше, чем это необходимо для нормального развития человека, для работы и хорошего самочувствия, ― мы полнеем.

Второй закон ― «соответствие химического состава рациона физиологическим потребностям организма в пищевых веществах». Питание должно быть разнообразным и обеспечивать потребности в белках, жирах, углеводах, витаминах, минеральных веществах, пищевых волокнах. Многие из этих веществ незаменимы, поскольку не образуются в организме, а поступают только с пищей. Отсутствие хотя бы одного из них, например, витамина С, приводит к заболеванию и даже смерти. Витамины группы В мы получаем главным образом с хлебом из муки грубого помола, а источником витамина А и других жирорастворимых витаминов являются молочная продукция, рыбий жир, печень.

Установлено, что у здорового человека среднего возраста при нормальной массе тела расходуется 7 килокалорий в час на каждый килограмм массы тела. Первым правилом в любой естественной системе питания должно быть: прием пищи только при ощущениях голода; отказ от приема пищи при болях, умственном и физическом недомогания, при лихорадке и повышенной температуре тела; отказ от приема пищи непосредственно перед сном, а также до и после серьезной работы, физической либо умственной. Очень важно иметь свободное время для усвоения пищи. Представление, что физические упражнения после еды способствуют пищеварению, является грубой ошибкой.

Прием пищи должен состоять из смешанных продуктов, являющихся источниками белков, жиров и углеводов, витаминов и минеральных веществ. Только в этом случае удается достичь сбалансированного соотношения пищевых веществ и незаменимых факторов питания, обеспечить не только высокий уровень переваривания и всасывания пищевых веществ, но и их транспортировку к тканям и клеткам, полное их усвоение на уровне клетки. Рациональное питание обеспечивает правильный рост и формирование организма, способствует сохранению здоровья, высокой работоспособности и продлению жизни.

Немаловажное значение оказывает на здоровье и состояние окружающей среды. Вмешательство человека в регулирование природных процессов не всегда приносит желаемые положительные результаты. Нарушение хотя бы одного из природных компонентов «приводит в силу существующих между ними взаимосвязей к перестройке сложившейся структуры природно-территориальных компонентов». Загрязнение поверхности суши, гидросферы, атмосферы и Мирового океана, в свою очередь, сказывается на состоянии здоровья людей, эффект «озоновой дыры» влияет на образование злокачественных опухолей, загрязнение атмосферы на состояние дыхательных путей, а загрязнение вод ― на пищеварение, резко ухудшает общее состояние здоровья человечества, снижает продолжительность жизни. Однако, здоровье, полученное от природы, только на 5% зависит от родителей, а на 50% ― от условий, нас окружающих.

Кроме этого, необходимо учитывать еще объективный фактор воздействия на здоровье ― наследственность. Влияют на наше здоровье и биологические ритмы. Одной из важнейших особенностей процессов, протекающих в живом организме, является их ритмический характер. В настоящее время установлено, что свыше трехсот процессов, протекающих в организме человека, подчинены суточному ритму.

Оптимальный двигательный режим ― важнейшее условие здорового образа жизни. Его основу составляют систематические занятия физическими упражнениями и спортом, эффективно решающие задачи укрепления здоровья и развития физических способностей молодежи, сохранения здоровья и двигательных навыков, усиления профилактики неблагоприятных возрастных изменений. При этом физическая культура и спорт выступают как важнейшее средство воспитания.

Для эффективного оздоровления и профилактики болезней необходимо тренировать и совершенствовать в первую очередь самое ценное качество ― выносливость в сочетании с закаливанием и другими компонентами здорового образа жизни, что обеспечит растущему организму надежный щит против многих болезней.

Еще одним важным элементом здорового образа жизни является личная гигиена. Личная гигиена включает в себя рациональный суточный режим, уход за телом, гигиену одежды и обуви. Особое значение имеет и режим дня. При правильном и строгом его соблюдении вырабатывается четкий ритм функционирования организма. А это, в свою очередь, создает наилучшие условия для работы и восстановления.

Неодинаковые условия жизни, труда и быта, индивидуальные различия людей не позволяют рекомендовать один вариант суточного режима для всех. Однако его основные положения должны соблюдаться всеми: «выполнение различных видов деятельности в строго определенное время, правильное чередование работы и отдыха, регулярное питание. Особое внимание нужно уделять сну — основному и ничем не заменимому виду отдыха. Постоянное недосыпание опасно тем, что может вызвать истощение нервной системы, ослабление защитных сил организма, снижение работоспособности, ухудшение самочувствия.

Режим имеет не только оздоровительное, но и воспитательное значение. Строгое его соблюдение воспитывает такие качества, как дисциплинированность, аккуратность, организованность, целеустремленность. Режим позволяет человеку рационально использовать каждый час, каждую минуту своего времени, что значительно расширяет возможность разносторонней и содержательной жизни. Каждому человеку следует выработать режим, исходя из конкретных условий своей жизни.

Здоровье помогает нам выполнять наши планы, успешно решать основные жизненные задачи, преодолевать трудности, а если придется, то и значительные перегрузки. Хорошее здоровье, разумно сохраняемое и укрепляемое самим человеком, обеспечивает ему долгую и активную жизнь.

Урогенитальные инфекции

Записаться

Урогенитальные инфекции – именно этот термин следует признать наиболее точным. Использование термина «скрытые инфекции», не определяет точный список инфекционных факторов. Все инфекции урогенитального тракта целесообразно разделить на абсолютно болезнетворные — Инфекции, Передаваемые Половым Путем (ИППП) куда относят возбудителей гонореи, хламидиоза, трихомониаза, сифилис, генитальный герпес, микоплазма гениталиум (Mycoplasma genitalium). Вторую группу составляют условно-патогенные микроорганизмы, т.е. те бактерии и грибы, которые имеются и у здоровых людей, но при определенных условиях становятся причиной воспаления. Ко второй группе относят стрептококки, стафилококки, кишечную палочку, клебсиеллу, энтерококк и еще много других. Термин «скрытые инфекции» вводит в заблуждение как пациента, так и самого врача. Ибо при выявлении микробов из группы условно-патогенных — лечение половых партнеров нецелесообразно, проводится лечение того органа, в котором эти бактерии вызвали воспаление (уретрит, простатит, цистит и др.)

Инфекции, Передаваемые Половым Путем (ИППП)

Гонорея – (Гонококковая инфекция) – инфекционное заболевание человека, передаваемое половым путем, вызываемое гонококками (Neisseria gonorrhoeae) — Грам-отрицательными диплококками, представляющими собой бобовидной формы, неподвижные, не образующие спор гноеродные бактерии. В настоящее время гонорея встречается нечасто, однако, стертые и малосимптомные формы в сочетании с устойчивостью к антибиотикам – особенности современного течения гонореи.

Хламидиоз – (Хламидийная инфекция) – инфекционное заболевание, передаваемое половым путём, возбудителем которого является Chlamydia trachomatis. Хламидии редко вызывают яркие симптомы, в связи с чем пациенты поздно узнают о своем заболевании, нередко, после развития осложнений со стороны половых органов. Хламидоз достаточно эффективно лечится. Длительность и объем лечения определяется отсутствием или наличием осложнений.

Трихомоноз – (Урогенитальный трихомониаз) — инфекция, передаваемая половым путем, возбудителем которой является Trichomonas vaginalis.  Отличительной особенностью заболевания является особенность возбудителя – по классификации это простейший микроорганизм. В лечении этой инфекции применяются антипротозойные препараты, антибиотики против трихомонад не эффективны.

Mycoplasma genitalium – патогенный микроорганизм, передаваемый половым путем, способный вызывать уретрит у лиц обоего пола, цервицит и воспалительные заболевания органов малого таза (ВЗОМТ) у женщин. Особенностью микроорганизма является его трудное выделение культуральным методом (метод посева на питательные среды). Единственным возможным методом диагностики в широкой медицинской практике являются методы, выявляющие ДНК (РНК) микроорганизма – это ПЦР, ПЦР-RT, NASBA.

Сифилис — инфекционное заболевание, вызываемое бледной трепонемой (Treponema pallidum), передаваемое преимущественно половым путем, характеризующееся поражением кожи, слизистых оболочек, нервной системы, внутренних органов и опорно-двигательного аппарата. В отличие от других инфекций имеет более продолжительный инкубационный период, который может еще более удлиняться, если пациенту были назначены антибиотики по поводу другой половой инфекции (например, хламидиоз). Следовательно, после любой половой инфекции должно быть назначено обследование на сифилис с учетом названных особенностей болезни.

Остроконечные кондиломы (Аногенитальные (венерические) бородавки) — вирусное заболевание, обусловленное  вирусом папилломы человека (HPV) и характеризующееся появлением  разрастаний на коже и слизистых оболочках наружных половых органов, уретры, влагалища, шейки матки, перианальной области, ануса. Лечение заключается в удалении кондилом. Наиболее предпочтительными методами являются лазерные методики. КЛИНИКА оборудована лазерным аппаратом — еСО2™ Lutronic . УНИКАЛЬНАЯ методика лазерного введения лекарственных препаратов-цитостатиков в кожу при лечении бородавок и кондилом большой площади; процедура с коротким сроком восстановления абсолютно безболезненна.

Для профилактики рецидивов применяются иммуномодуляторы с противовирусной активностью. Также мы проводим исследование иммунного статуса с определением индивидуальной чувствительности к иммуномодулирующим препаратам.

Группа условно-патогенных микроорганизмов – присутствуют в норме и у здоровых людей, болезнетворные свойства этой группы бактерий проявляются при определенных условиях.

Микоплазмы и уреаплазмы (часто применяется термин миrjплазмоз/уреаплазмоз) — Mycoplasma hominis и Ureaplasma urealyticum, Ureaplasma parvum (для обозначения сразу двух видов применяется обозначение Ureaplasma spp. ) – условно-патогенные микроорганизмы, проявление патогенных свойств которых происходит при определённых условиях. Уреаплазмы способны вызывать уретрит у мужчин (U. urealyticum) и цервицит, цистит, ВЗОМТ, а также осложнения течения беременности, послеродовые и послеабортные осложнения у женщин.

Уреаплазмы и M. hominis могут выявляться у  здоровых лиц (в 5-20% наблюдений). Лечение этих инфекций проводится только после всестороннего обследования и исключения роли других инфекций, прежде всего из группы ИППП.

Кишечная палочка, энтерококк, клебсиелла, стрептококки – микроорганизмы, также относящиеся к условно-патогенным, в норме встречаются в кишечнике. Нередко выявляются как причина воспаления мочевого пузыря (цистит), предстательной железы (простатит), влагалища (вагинит) и других заболеваний. В диагностике требуется не только простое выделение возбудителя культуральным методом, необходимо также доказать факт воспаления – по повышенному уровню лейкоцитов (в мазках или секрете простаты).

Показательные неравенства — как решать? Примеры, методы решения и свойства

Статья находится на проверке у методистов Skysmart.
Если вы заметили ошибку, сообщите об этом в онлайн-чат
(в правом нижнем углу экрана).

Определение показательных неравенств

Показательными считаются неравенства, которые включают в себя показательную функцию. Другими словами, это неравенства с переменной в показателе степени: af(x) > ag(x), af(x) < ag(x).

Из них показательно-степенными неравенствами являются те, в которых есть переменные и в показателе степени, и в основании.

Для изучения этой темы стоит повторить:

И, конечно, для решения тригонометрических и логарифмических показательных неравенств также придется вспомнить формулы соответствующих разделов алгебры.

Если все это еще свежо в памяти, давайте приступим. Как и к показательным уравнениям, к неравенствам стоит подходить, помня о свойствах показательной функции. Напомним, что она выглядит так: y = ax, где a > 0 и a ≠ 1. Два графика ниже дают представление о том, на что похожа такая функция, когда основание степени а больше и меньше единицы. Наверняка вы уже догадались, каково главное свойство этой функции. Да, она монотонна.

При этом заметьте — значения а всегда больше нуля. На практике в этом несложно убедиться, если возводить какое-либо число во всевозможные степени, включая отрицательные. Например: 2-2 = 4, 2-4 = 1/16 и т. д. Значение функции будет уменьшаться, но никогда не достигнет нуля.

Для любых а и х верно неравенство ax > 0, т. е. показательная функция не принимает отрицательных значений.

Запишем следствие монотонности показательной функции в виде формул:

  • af(x) > ag(x) <-> f(x) > g (x), когда функция возрастает, т. е. а > 1;
  • af(x) > ag(x) <-> f(x) < g (x), когда функция убывает, т. е. 0 < а < 1.

На этом свойстве показательных неравенств так или иначе основываются все методы решения, и сейчас мы разберемся, как им пользоваться.

Как решать показательные неравенства

Как мы уже говорили, для успешного освоения этой темы нужно хорошенько повторить все, что касается показательных уравнений. Способы решения показательных неравенств выглядят примерно так же — мы будем пытаться упростить выражение, получить одинаковые степени или одинаковые основания, по возможности свести все к квадратному или рациональному уравнению. Но есть и свои тонкости…

Допустим, у нас есть простейшее показательное неравенство:

3х > 9

Если вы помните, как решались показательные уравнения, не придется долго думать, что делать с таким неравенством — приведем его к одинаковому основанию:

3х > 32

х > 2

Казалось бы, все логично, но всегда ли можно смело вычеркивать одинаковые основания степеней? А что, если вместо 3 у нас основание степени будет 0,5? Посмотрим:

0,5х > 0,52

Проверим, верно ли в таком случае х > 2.

0,52 = 0,25;

0,53 = 0, 125 и т. д.

Как видите, на самом деле в этом случае х < 2. Неудивительно, если вспомнить, о чем мы писали в самом начале, когда рисовали графики возрастающей и убывающей показательной функции.

Если а > 1, то ax > an <-> a > n, и при решении неравенства можно просто убрать одинаковые основания степени.

Если 0 < а < 1, то ax > an <-> a < n, т. е. одинаковые основания по-прежнему можно убрать, но при этом необходимо поменять знак неравенства.

Если a = 1, то решений нет, т. к. единица в любой степени равна сама себе.

Наконец, если рассмотреть случай, когда а < 0, получится неопределенность. Допустим:

(-3)х > 9

(-3)х > 32

Логичное, на первый взгляд, предположение, что х > 2, не выдержит проверки, потому что:

х = 3 -> (-3)3 = -27

х = 4 -> (-3)4 = 81

х = 5 -> (-3)5 = -243

Если продолжить этот ряд, знаки будут чередоваться, и наш корень будет попеременно то меньше, то больше 2. Поэтому для ясности всегда предполагается, что основание степени — положительное число.

Это были общие правила, а сейчас рассмотрим разные виды показательных неравенств и примеры с решениями.

Курсы подготовки к ОГЭ по математике от Skysmart придадут уверенности в себе и помогут освежить знания перед экзаменом.

Показательные неравенства, сводящиеся к простейшим

Решая показательные уравнения, вы наверняка первым делом исследовали их на возможность приведения к одинаковым основаниям или одинаковым степенным функциям. Так вот, с неравенствами можно делать то же самое! Помните лишь о смене знака, если основание степени меньше единицы. И да пребудет с вами сила. 😎

Попробуем на примере несложного показательного неравенства с разными основаниями.

Пример 1

3х < 243

3х < 35

Поскольку 3 больше 1, знак не меняем:

х < 5

Ответ: х ∈ (−∞; 5).

Пример 2

(1/2)х > √8

(1/2)х > 23/2

(1/2)х > (1/2)-3/2

х < -3/2, обратите внимание — мы поменяли знак, поскольку 1/2 < 1.

Ответ: х ∈ (-∞; -3/2).

Показательные неравенства, сводящиеся к квадратным

Снова давайте вспомним, как аналогичный метод применялся к показательным уравнениям. Если все переменные имели общий множитель, его можно было обозначить новой переменной — в итоге у нас, как правило, получалось квадратное уравнение. Нужно было лишь найти дискриминант и произвести обратную замену. И снова алгоритм решения показательных неравенств будет совершенно таким же.

Пример 1

9х + 27 < 12 × 3х

Наименьший общий множитель в данном случае будет 3х, обозначим его новой переменной у и перенесем все слагаемые в левую сторону.

9х + 27 < 12 × 3х

(3х)2— 12 × 3х + 27 < 0

3х = у

y2 — 12y + 27 < 0

3 < y < 9

Пришло время выполнить обратную замену.

3 < 3х < 9

31 < 3х < 32

Поскольку 3 > 1, мы не меняем знак.

1 < х < 2

Ответ: х ∈ (1;2).

Пример 2

2sin2x — 5 sinx + 2 < 0

Это более сложное показательное неравенство, но и в нем можно угадать скрытое уравнение квадратичной функции — достаточно заменить sinx на новую переменную.

sinx = y

2y2— 5y + 2 < 0

y = 2

y = 1/2

1/2 < y < 2

Произведем обратную замену:

1/2 < sinx < 2

Поскольку sinx и так меньше 1, а значит, точно меньше 2, мы можем отбросить правую часть неравенства и сосредоточиться только на левой.

1/2 < sinx

Воспользуемся формулой х c (arcsina + 2πn; π — arcsina + 2πn), n ∈ z

х c (arcsin 1/2 + 2πn; π — arcsin 1/2 + 2πn), n ∈ z

х c (π/6 + 2πn; π — π/6 + 2πn), n ∈ z

х c (π/6 + 2πn; 5π/6 + 2πn), n ∈ z

Ответ: х ∈ (π/6 + 2πn; 5π/6 + 2πn), n ∈ z

Показательные неравенства, сводящиеся к рациональным

Как вы, наверное, помните из предыдущего курса алгебры, рациональные показательные неравенства — это такие, в которых левая и правая часть представляют собой дробно-рациональные функции. Метод их решения таков: нужно перенести все в левую часть, чтобы в правой остался лишь ноль, и привести к общему знаменателю. Далее решаем уравнение, отмечаем все корни на оси и применяем метод интервалов (если забыли, что это такое — повторите).

Важно помнить: если в числителе и знаменателе встретятся одинаковые множители с переменной, сокращать их нельзя.

Пример 1

Преобразуем неравенство указанным выше способом:

(обратите внимание, мы избавились от минуса в числителе и поменяли знак неравенства).

Поскольку выражение 2х + 2 в любом случае будет больше нуля, мы можем смело его исключить из неравенства.

(2х— 2) × (2х— 1/2) × (2х— 3) > 0

1/2 < 2х < 2

2х > 3

и

-1 < х < 1

х > log23

Ответ: х ∈ (-1;1) U (log23; +∞)

Пример 2

Обозначим 3х через новую переменную y:

3х = y, при условии что 3х > 0.

Применим метод интервалов и получим:

y c (1/3; 3)

Вернем на место нашу старую переменную:

3-1 < 3х <= 3

Поскольку 3 больше 1, знаки не меняем:

-1 < х <= 1

Ответ: х ∈ (-1;1).

Однородные показательные неравенства

Однородными называются такие показательные неравенства, где в каждом слагаемом сумма степеней одинакова.

Иногда такие выражения бывают очень длинными и запутанными, но не стоит этого пугаться. Практически все неравенства с однородными показательными функциями решаются по одному принципу: стараемся упростить выражение, разделив его на одночлен, а затем при необходимости делаем замену переменных.

Пример 1

4х — 2 × 5 — 2х × 5х > 0

2 × 2х — 2 × 5 — 2х × 5х > 0

В левой части неравенства мы видим однородные функции относительно 2х и 5х. Следовательно, можно разделить обе части на 2 или 5. Выберем 5, т. е. 25х. В итоге у нас получится:

Если обозначить (2/5)х новой переменной y, получим квадратное неравенство:

y2— y — 2 > 0

y1 > 2

y2 < -1

Исходя из этого, у нас образуется следующее неравенство:

Поскольку 2/5 меньше 1, функция убывающая и мы должны поменять знак:

х < log2/52

Ответ: х ∈ (-∞; log2/52).

Пример 2

Но где здесь одинаковая сумма степеней? Сейчас будет:

Ответ: х ∈ (-∞; +∞) / (-2; 3)

Неравенства, решаемые графическим методом

Этот метод решения показательных неравенств — самый наглядный, и для многих он может показаться самым простым. Нужно лишь построить графики функций, заданных в левой и правой части выражения, а затем посмотреть, в какой точке они пересекаются. Если бы мы имели дело с уравнением, эта точка стала бы корнем.

Но поскольку мы рассматриваем неравенства, нужно будет выделить искомую область. Для неравенства f(x) > g(x) это будет та область, где график функции f(x) находится выше.

Пример 1

2х <= 3-х

Итак, нам нужны графики двух функций: 2х и 3 — х, а также точка их пересечения.

Очевидно, что точкой пересечения является х = 1, при этом график функции 2х ниже в области от -∞ до 1.

Ответ: х ∈ (-∞; 1).

Пример 2

(1/2)х > х + 3

Начертим графики этих двух функций, чтобы найти точку пересечения.

Искомой точкой будет х = -1, а областью, где функция (1/2)х находится выше — диапазон от -∞ до -1.

Ответ: х ∈ (-∞; — 1).

CBSE Free NCERT Solution 11th Biology Biological Classification кратко описывает четыре основные группы простейших (19 марта 2022 г.)

Вопрос 6

Ответить

Простейшие — это микроскопические одноклеточные эукариотические организмы с гетеротрофным способом питания. Их питание может быть голозойным, сапробным или паразитарным. Они разделены на четыре основные группы.

(1) Амебоидные простейшие или саркодины

Это одноклеточные желеобразные простейшие, встречающиеся в пресной или морской воде и во влажной почве.В их теле отсутствует перипласт. Поэтому они могут быть голыми или покрытыми известковой оболочкой. У них обычно отсутствуют жгутики, и они имеют временные протоплазматические выросты, называемые псевдоподиями для передвижения. Эти псевдоподии или ложные ноги помогают в движении и захвате добычи. К ним относятся свободноживущие формы, такие как амебы, или паразитические формы, такие как энтамебы.


(2) Жгутиковые простейшие или зоофлагелляты

Это свободноживущие нефотосинтезирующие жгутиконосцы без клеточной стенки.У них есть жгутики для передвижения и захвата добычи. К ним относятся паразитические формы, такие как Trypanosoma , вызывающая у людей сонную болезнь, и свободноживущие формы, такие как Noctiluca.

(3) Реснитчатые простейшие или инфузории

Это водные особи, образующие большую группу простейших. Их характерными особенностями являются наличие многочисленных ресничек по всей поверхности тела и наличие двух типов ядер. Все реснички двигаются в одном направлении, чтобы переместить насыщенную водой пищу внутрь полости, называемой пищеводом. К ним относятся такие организмы, как Paramaecium, Vorticella и т. д.

(4) споровики

К ним относятся болезнетворные эндопаразиты и другие патогены. Они одноядерные, а их тело покрыто пелликулой. У них нет ни ресничек, ни жгутиков. Они включают малярию, вызывающую паразита Plasmodium.

Простейшие кишечные паразиты

Краткое содержание курса

Нажмите на ссылки ниже, чтобы предварительно просмотреть выбранные страницы этого курса.

  • 9004
    • Введение в кишечную паразитарную простейшую простейшую
    • Обзор диагностических техник
    • Жизненные циклы, эпидемиология, заболевания и диагностика амебля
    • Жизненные циклы, эпидемиология, заболевания и диагностика жгутиков
        • Патогенных противы комменсального жгутиковые
        • Giardia и Dientamoeba Life Cycles
        • Giardia и Dientamoeba Эпидемиология и болезнь
        • Дифференцируя Giardia и Dientamoeba Трофозоиты от комменсальных жгутиковых Trophs
        • дифференцирующей Giardia и Dientamoeba кист от тех комменсальных жгутиконосцев
        • Другие методы диагностики Giardia и Dientamoeba
        • Врач подозревает, что пациент может быть инфицирован Giardia, и назначает обследование O&P. Исследование мазка, окрашенного трихромом, на рассыпном…
        • Сопоставьте трофозоит с изображением мазка, окрашенного трихромом.
        • Наилучшие методы диагностики трофозоитов G. duodenalis включают: (выберите все подходящие варианты) Заболевание, вызванное Balantidium coli
        • Диагностика Balantidium coli
        • Назначен осмотр O&P.Отмечается подозрение на инфекцию Blantidium coli. Лучший способ диагностики:
    • Другие кишечные протисты: Blastocystis и Sporozoa (филум апикокомплексы), и микроспоридия
        • Blastocystis SPP: эпидемиология, болезнь и жизненный цикл
        • Blastocystis Diankish
        • кишечник споровики: Cryptosporidium spp., Cyclospora cayetanensis, Cystoisospora belli и Sarcocystis spp.
        • Cryptosporidium spp.
        • Cyclospora cayetanensis
        • Cystoisospora belli (ранее Isospora belli)
        • Sarcocystis spp.
        • Микроспоридии
        • Краткий обзор морфологических признаков бластоцист, споровиков и микроспоридий
        • Для споровиков характерны все перечисленные признаки, кроме:
        • структуры размером 8-10 мкм. Наиболее вероятный диа…
        • Организмы, относящиеся к группе Microsporidia, имеют облигатную внеклеточную фазу развития.
    • Каталожные номера

    Дополнительная информация

    Уровень обучения : от базового до среднего

    Предполагаемая аудитория : Медицинские лаборанты, медицинские лаборанты, резиденты патологии, студенты MLS и другой медицинский персонал, который интересуется этой темой.

    Информация об авторе: Маргарет Рейнхарт, MS, MT (ASCP) — старший преподаватель биологических наук в Университете наук в Филадельфии, штат Пенсильвания, где она преподает гематологию, клиническую иммунологию, паразитологию и другие смежные курсы.Она также является адъюнкт-инструктором по гематологии в больнице Пенсильвании, Филадельфия, штат Пенсильвания. Она была директором программы MLS в Университете наук в течение 30 лет. Она имеет степень магистра биологии и управления здравоохранением.

    Информация рецензента:     

    Дайан М. Валентин, MS, MT(ASCP)MB – г-жа Валентин, выпускница Университета наук в Филадельфии. Г-жа Валентин — выпускница Университета наук в Филадельфии (MT ’99), которая с момента окончания учебы работает медицинским лаборантом.Она также получила степень магистра наук в области биомедицинской информатики со специализацией в области биоинформатики в Университете Рутгерса и сертификат в области молекулярной лабораторной диагностики Университета штата Мичиган. Она имеет два сертификата Американского общества клинической патологии (ASCP): медицинский технолог и технолог в области молекулярной биологии.

    Рори Хушка, M. Ed., MT (ASCP), имеет более чем 20-летний опыт работы в качестве медицинского технолога, технического руководителя, профессора и менеджера.Он является бывшим директором программ клинических лабораторных исследований и медицинских лаборантов в Бруклинском колледже. В настоящее время он является программным директором в MediaLab, Inc. Рори имеет степень бакалавра медицинских технологий Университета штата Северная Дакота и степень магистра в области управления образованием.

    разлагателей | National Geographic Society

    Если у вас есть пустая бутылка, вы перерабатываете ее, чтобы можно было снова использовать пластик или стекло? У природы есть собственная система рециркуляции: группа организмов, называемых редуцентами.

    Редуценты питаются мертвыми вещами: мертвыми растительными материалами, такими как опавшие листья и древесина, трупами животных и фекалиями. Они выполняют ценную службу в качестве команды по очистке Земли. Без редуцентов мертвые листья, мертвые насекомые и мертвые животные скапливались бы повсюду. Представьте, как бы выглядел мир!

    Что еще более важно, редуценты делают жизненно важные питательные вещества доступными для первичных производителей экосистемы — обычно растений и водорослей. Редуценты расщепляют сложные органические вещества на более простые вещества: воду и углекислый газ, а также простые соединения, содержащие азот, фосфор и кальций. Все эти компоненты являются веществами, которые необходимы растениям для роста.

    Некоторые разлагатели специализированы и разрушают только определенный вид мертвых организмов. Другие — универсалы, которые питаются множеством разных материалов. Благодаря редуцентам питательные вещества попадают обратно в почву или воду, поэтому производители могут использовать их для выращивания и размножения.

    Большинство редуцентов представляют собой микроскопические организмы, в том числе простейшие и бактерии. Другие редуценты достаточно велики, чтобы их можно было увидеть без микроскопа.К ним относятся грибы, а также беспозвоночные организмы, иногда называемые детритофагами, в том числе дождевые черви, термиты и многоножки.

    Грибы являются важными редуцентами, особенно в лесах. Некоторые виды грибов, например грибы, выглядят как растения. Но грибы не содержат хлорофилла, пигмента, который зеленые растения используют для производства своей пищи с помощью энергии солнечного света. Вместо этого грибы получают все свои питательные вещества из мертвых материалов, которые они расщепляют специальными ферментами.

    В следующий раз, когда вы увидите лесную подстилку, покрытую опавшими листьями, или мертвую птицу, лежащую под кустом, найдите минутку и оцените разлагающих организмов за то, как они поддерживают поток питательных веществ в экосистеме.

    Границы | Изучение прокариотического сообщества, связанного с популяцией инфузорий рубца Protozoa

    Введение

    Простейшие инфузории представляют собой разнообразную группу эукариотических микроорганизмов, повсеместно распространенных во многих средах и, как известно, живут в тесной связи с окружающим их прокариотическим сообществом (Dziallas et al., 2012; Newbold et al., 2015). Было показано, что прокариотические виды, связанные с простейшими, обладают широким спектром функций, способствуя приспособленности принимающей их клетки (Gast et al., 2009). Было показано, что прокариоты, ассоциированные с простейшими, служат поглотителями электронов посредством фиксации азота, ацетогенеза или метаногенеза (Yamada et al. , 1997; Ohkuma et al., 2015; Tai et al., 2016), обеспечивают защиту от хищников (Vannini et al., 2003; Görtz, 2006; Montagnes et al., 2008) или служат питанием для клетки-хозяина (Gast et al., 2009; Dziallas et al., 2012; Williams, Coleman, 2012). Природа микробной ассоциации может быть экто- или эндосимбиотической, постоянной или временной, облигатной или преходящей (Gast et al., 2009; Newbold et al., 2015) и, как считается, приносит пользу как хозяину (Yamada et al., 1997; Vannini et al., 2003), так и связанным с ним симбиотическим прокариям (Newbold et al., 2015).

    Простейшие инфузории являются неотъемлемой частью микробиома рубца и составляют значительную часть его микробной биомассы (Newbold et al., 2015). В рубце обычно наблюдаются простейшие, содержащие внутриклеточные и внеклеточные прокариотические клетки, часть которых, как считается, находится в симбиотических отношениях с клеткой-хозяином (Fenchel and Finlay, 1992; Finlay et al., 1994; Ллойд и др., 1996; Хакштейн и Фогельс, 1997).

    Повторяющееся наблюдение о том, что удаление простейших из рубца снижает выделение кишечного метана, привело к увеличению числа исследований, связанных с простейшими и их связью с метаногенными археями, единственными производителями метана в рубце (Hook et al., 2010; Malmuthuge и Гуань, 2017 г.; Уоллес и др., 2017 г.). По оценкам нескольких исследований, относительный вклад простейших в выделение метана в рубце может достигать 37% (Finlay et al., 1994; Хук и др., 2010; Моргави и др., 2010). Недавний метаанализ, объединяющий 30-летние экспериментальные процедуры удаления простейших из рубца, показал снижение выделения метана в среднем на 11% (Newbold et al., 2015). Кроме того, исследований in vitro демонстрируют тесное метаболическое взаимодействие между метаногенами и инфузориями, при котором смешанные или отдельные виды инфузорий, инкубированные с прокариотическим сообществом рубца, приводят к увеличению продукции метана (Newbold et al., 1995; Ушида и др., 1997; Ранилла и др. , 2007).

    Таким образом, изучение состава метаногенного сообщества, связанного с простейшими, и их функций стало предметом многих исследований, направленных на поиск новых стратегий смягчения последствий выбросов метана (Tapio et al., 2017; Wallace et al., 2017).

    Недавние исследования, сравнивающие свободноживущее метаногенное сообщество в рубце с сообществом, ассоциированным с простейшими, выявили различия в составе метаногенов, при этом Methanobrevibacter является доминирующим родом, связанным с простейшими (Tymensen et al., 2012; Беланш и др., 2014; Ван и др., 2017). В качестве возможной причины его доминирования была предложена в основном гидрогенотрофная природа этого рода, поскольку простейшие рубца продуцируют большое количество H 2 в ходе своего метаболизма (Paul et al., 1990). Напротив, таксоны, принадлежащие к кладе метилотрофных RCC класса Thermoplasmata, недавно переклассифицированные как принадлежащие к семейству Methanomassiliicoccaceae (Paul et al. , 2012; Iino et al., 2013; Whitman et al., 2015), были показаны более заметными. в свободноживущем сообществе (Tymensen et al., 2012). Физическое взаимодействие между простейшими и прокариотами наблюдали также с помощью флуоресцентных зондов, нацеленных на 16S рДНК архей и бактерий. Ллойд и др. (1996) наблюдали обширное присутствие вне- и внутриклеточных прокариотических клеток у разных видов простейших, локализованных в разных компартментах внутри протозойных клеток. Это исследование также показало, что колонизация не ограничивается археями, и дополнительно идентифицировало бактериальные клетки, связанные с простейшими.

    В отличие от повышенного внимания к метаногенам, полученным в связи с их связью с простейшими, характеристике бактериальных сообществ, связанных с простейшими в рубце, уделялось мало внимания, а также их составу и роли, если таковые имеются, помимо того, что они служат питанием для хищных инфузорий, остается неясным (Lloyd et al., 1996; Ирбис и Ушида, 2004). В этом исследовании мы выделили различные фракции размера простейших, обнаруженные в рубце крупного рогатого скота, и охарактеризовали экологические особенности и динамику связанной с ними прокариотической популяции. Далее мы оценили различия в идентичности и составе прокариотического сообщества, связанного с разными популяциями простейших.

    Материалы и методы

    Обращение с животными и отбор проб

    Экспериментальные процедуры, использованные в этом исследовании, были одобрены Комитетом факультета по политике и благополучию животных Сельскохозяйственной исследовательской организации Volcani Research Center.737/17 IL, в соответствии с рекомендациями Израильского совета по уходу за животными.

    Жидкость рубца была отобрана у трех коров, у двух из которых образцы были взяты пять раз в течение 1 месяца, а у одной коровы образцы были взяты дважды, когда животные содержались на одном и том же рационе (дополнительная таблица S1). Отобранную жидкость рубца пропускали через восемь слоев марли и немедленно переносили в бескислородную среду в анаэробном перчаточном боксе. Чтобы получить различные популяции простейших, свободных от внешнего загрязнения, из свободноживущей популяции прокариот, образцы рубца подвергли серии фильтраций по размеру и промываниям, аналогичным процедуре, выполненной в Belanche et al. (2014). Вкратце, жидкость рубца смешивали в соотношении 1:1 с подогретым анаэробным буфером Коулмана (Williams and Coleman, 2012) и инкубировали в делительной воронке в течение 1 ч в анаэробных условиях при 39°C. Осевшую фракцию простейших переносили в свежую пробирку с теплым буфером Коулмана и подвергали последовательной фильтрации с использованием нейлоновых сетчатых фильтров (Merck Millipore, Дармштадт, Германия) разных размеров (т.е. 100 мкм, 60 мкм, 40 мкм, 10 мкм). Затем ретентат на каждом фильтре и фильтрат после фильтрации 10 мкм промывали теплым анаэробным буфером Коулмана.Каждую фракцию промывали четыре раза центрифугированием при 500× g в течение 5 мин с последующей заменой буфера. Фракция P-<10 имела дополнительную стадию промывки, так как предыдущие попытки показали, что некоторое внешнее загрязнение оставалось после четырех промывок. Промывочный раствор с последней стадии промывки центрифугировали при 10 000 × г в течение 5 мин и ресуспендировали в 3 мл буфера. На оставшемся промывочном растворе была проведена прямая ПЦР, чтобы подтвердить удаление свободноживущих загрязнений в отфильтрованных образцах (дополнительная фигура S1).Свободноживущая фракция была получена из всего образца рубца путем отдельной инкубации в буфере Коулмана и дважды центрифугирована при 500 × г для удаления фракции простейших из свободноживущих бактерий. Только две трети супернатанта сохраняли, чтобы свести к минимуму заражение осевшими простейшими.

    Экстракция ДНК

    Экстракцию ДНК

    проводили, как описано ранее (Stevenson and Weimer, 2007). Вкратце, клетки лизировали путем разрушения шариков с использованием Biospec Mini-Beadbeater-16 (Biospec, Bartlesville, OK, United States) при 3000 об/мин в течение 3 минут с фенолом с последующей экстракцией ДНК фенолом/хлороформом.Конечный супернатант осаждали 0,6 объема изопропанола и ресуспендировали в течение ночи в 50–100 мкл ТЕ-буфера (10 мМ Трис-HCl, 1 мМ ЭДТА), затем хранили при 4°С для кратковременного использования или архивировали при -80°С. С.

    Количественная ПЦР в реальном времени

    Количественный ПЦР-анализ в реальном времени был проведен для количественной оценки общего количества бактерий, метаногенов и простейших инфузорий с использованием метода стандартной кривой (Yuan et al., 2006). Вкратце, стандартную кривую строили для каждой из последовательностей путем амплификации серийных 10-кратных разведений продуктов ПЦР, экстрагированных из геля, полученных в результате амплификации каждого ампликона.ПЦР в реальном времени проводили в 10 мкл реакционной смеси, содержащей 5 мкл Absolute Blue SYBR Green Master Mix (Thermo Scientific, Уолтем, Массачусетс, США), 0,5 мкл каждого праймера (рабочая концентрация 10 мкМ), 3 мкл нуклеазы -свободная вода и 2 мкл матриц ДНК по 10 нг. Амплификация включала один цикл выдержки при 95°С в течение 15 мин для начальной денатурации и активации полимеразной системы горячего старта, затем 40 циклов при 95°С в течение 10 с с последующим отжигом при 60°С в течение 15 с и удлинением при 72 °С в течение 20 с. Последовательности праймеров для всех бактерий были взяты из Walter et al. (2000 г.); HDA-прямой ACTCCTACGGGAGGCAGCAG и HDA-обратный 5′ GTATTACCGCGGCTGCTGGCAC 3′. Последовательности 16S рРНК для метаногенов взяты из Zhou et al. (2010 г.); UniMet-прямой 5’CCGGAGATGGAACCTGAGAC3′ и UniMet-обратный 5’CGGTCTTGCCCAGCTCTTATTC3′. Последовательности праймеров 18S рРНК для инфузорий для ПЦР в реальном времени были такими же, как последовательности, использованные для секвенирования (Tapio et al., 2016).

    Illumina Amplicon Sequenceing and Data Analysiss

    Исследовательская лаборатория Hylab (Реховот, Израиль) провела ампликонное секвенирование образцов ДНК рубца следующим образом: 20 нг ДНК использовали в 25 мкл реакции ПЦР с праймерами с использованием ДНК-полимеразы PrimeStar Max (Takara) в течение 20 циклов.Реакцию ПЦР очищали с использованием гранул AmpureXP, а затем проводили вторую ПЦР с использованием праймеров Fluidigm Access Array для Illumina для добавления последовательностей адаптера и индекса. Для этой реакции 2 мкл первой ПЦР амплифицировали в 10 мкл реакции в течение 10 циклов. Реакцию ПЦР очищали с использованием шариков AmpureXP, а концентрации измеряли с помощью Qubit. Образцы объединяли, запускали на пленке ДНК D1000 (Agilent) для проверки правильности размера и отсутствия продукта праймер-димер.Затем пул секвенировали на приборе Illumina MiSeq с использованием набора для секвенирования MiSeq V2-500 cycles. Последовательности праймеров, использованные для 16S рДНК бактерий и архей, были взяты из обновленных последовательностей (с 2015 г. по настоящее время) проекта микробиома Земли, амплифицирующих область V4 515F (5′-GTGYCAGCMGCCGCGGTAA-3′) и 806R (5′-GGACTACNVGGGTWTCTAAT- 3′). Секвенирование проводили на платформе MiSeq с использованием протокола парных концов (2 × 250 п.н.). Для секвенирования 18S рДНК использовали праймеры, специально разработанные для инфузорий Tapio et al.(2016) со следующими последовательностями: CiliF (5′-CGATGGTAGTGTATTGGAC-3′) и CiliR (5′-GGAGCTGGAATTACCGC-3′). Данные секвенирования были депонированы в архив чтения последовательностей (SRA) NCBI, и к ним можно получить доступ через номер доступа SRP156491.

    Анализ данных

    Нисходящая обработка данных 16S рДНК вплоть до создания таблиц OTU выполнялась в QIIME v.1.9.1 (Caporaso et al., 2011). После удаления ридов низкого качества ниже Q24, последовательностей короче 200 п.н. и удаления химер с использованием Uchime (Edgar et al., 2011), процедура pick_open_reference_OTU использовалась с Usearch v.6.1 (Edgar, 2010) с порогом подобия 97% для кластеризации OTU. Таксономическое определение бактериального 16S было выполнено с использованием BLAST по последней версии базы данных Greengenes (greengenes_13_8).

    После таксономического отнесения считывания, принадлежащие типам Chloroflexi и Cyanobacteria, были дополнительно удалены из набора данных, поскольку эти последовательности могут быть продуктом амплификации хлоропластов, обычно встречающейся у простейших, и их нельзя с уверенностью отнести к бактериальному домену (Huws et al. , 2012). Для таксономического определения последовательностей архей использовалась база данных Rumen and Intestinal Methanogen (RIM-DB), которая позволяет проводить более глубокую классификацию метаногенных таксонов рубца, для классификации метаногенных OTU в соответствии с определенными кладами (Seedorf et al., 2014).

    После создания таблицы OTU одиночные/дублтоны были удалены, и для всех последующих анализов была выполнена подвыборка до четной глубины 14 000 прочтений на образец. Анализ альфа- и бета-разнообразия выполнялся с использованием сценария рабочего процесса core_diversity_analysis.ру в QIIME. Было использовано неметрическое многомерное шкалирование (NMDS) с использованием показателя несходства Брея-Кертиса, основанного на составе OTU (идентичность OTU > 97%, сходство на уровне видов) и построено с использованием программного обеспечения PAleontological STatistics (PAST) (Hammer et al., 2001). . Скорректированный Бонферрони анализ подобия (ANOSIM) использовался для проверки значимости групповой кластеризации, а скорректированная Бенджамини-Хохбергом процедура Стьюдента t -испытания использовалась для оценки различий в средней изменчивости между образцами из разных фракций по животным и временным точкам. .Тепловая карта и иерархическая кластеризация данных об относительной численности 16S рДНК были созданы с помощью пакета heatplus в R (Ploner, 2006). Для тепловой карты данные журнала 10 были преобразованы для лучшей визуализации. Данные 18S рДНК инфузорий подверглись тем же процедурам анализа данных, за исключением порога сходства для определения OTU, который был установлен на уровне 100% сходства, а таксономическое присвоение было выполнено с использованием курируемой базы данных, созданной Kittelmann et al. (2015).Статистический анализ композиционных различий между фракциями был выполнен с использованием критерия Крускала-Уоллиса для оценки общих значимых различий между фракциями. Когда Крускал-Уоллис указал на значительную разницу между группами, был проведен тест суммы рангов post hoc Уилкоксона, чтобы определить, какие парные группы отличаются друг от друга. Для всех анализов значимыми считались значения P <0,05 после коррекции FDR с использованием процедуры Бенджамини-Хохберга (Benjamini and Hochberg, 1995).

    Результаты

    Относительная количественная оценка архей, бактерий и инфузорий рубца

    Мы количественно определили обилие бактерий и метаногенов и их относительную распространенность в связи с различными популяциями простейших и свободноживущими сообществами, используя ПЦР в реальном времени. Этот анализ показал, что соотношение метаногенов/бактерий во фракциях простейших значительно выше по сравнению с соотношением, обнаруженным во фракции свободноживущих (ранговая сумма Уилкоксона, P <0.05; Рисунок 1А). Сообщества, полученные из более крупных фильтров П-100, П-60, имели самую высокую долю метаногенов по отношению к бактериям в среднем ~6% и ~8%. Фракции Р-40, Р-10 и Р-<10 имели относительную долю 2,6%, 1,9% и 2,6% метаногенов/бактерий. Сообщество свободноживущих прокариот содержало 0,8% архей по отношению к бактериям, что было значительно ниже, чем в образцах, ассоциированных с простейшими (ранговая сумма Уилкоксона, P <0,01; рис. 1). Соотношение между бактериальным 16S и простейшим 18S не отличалось между большинством фракций и составляло в среднем 1. 3:10 бактерии/простейшие, за исключением P-<10, у которого было значительно более высокое соотношение бактерий/простейших 1:3 (рис. 1В). Копии 16S метаногена были в значительно более высокой пропорции к 18S простейшим в P-100, P-60 и P-<10 с 1:150, 1:120 и 1:113, соответственно, по сравнению с P-40 и P-10. с соотношением 1:330 и 1:400 (сумма рангов Уилкоксона; P <0,01; рис. 1C).

    РИСУНОК 1. Соотношение бактерий архей и простейших в различных фракциях с использованием ПЦР в реальном времени. (A) Соотношение между археями 16S и бактериями 16S в свободноживущем сообществе рубца и каждой фракции простейших, полученное фильтрацией по размеру. (B) Соотношение между копиями 16S бактерий и 18S простейших. (C) Соотношение количества копий 16S архей и копий 18S простейших. Прямоугольники представляют межквартильный диапазон (IQR) между первым и третьим квартилями (25-й и 75-й процентили соответственно), а горизонтальная линия внутри прямоугольника определяет медиану. Усы представляют самые низкие и самые высокие значения в пределах 1,5-кратного IQR из первого и третьего квартилей соответственно. Значимость была выполнена с использованием критерия суммы рангов Уилкоксона, скорректированного для множественных сравнений с использованием процедуры Бенджамини-Хохберга. Надписи над прямоугольниками указывают на скорректированную значимость между дробями с прямоугольниками, не имеющими общих букв, которые значительно различаются при P <0,05.

    Состав простейших инфузорий в фильтрах разного размера

    Мы оценили состав простейших в различных фракциях, используя секвенирование ампликона 18S (Tapio et al., 2016). Контроль качества и удаление химер с использованием конвейера QIIME привели к 1 942 623 считываниям качества, в среднем 30 305 ± 1325 считываний на образец. Общее количество OTU, обнаруженных в результате анализа, достигло 9525 на основе 100% идентичности последовательностей нуклеотидов между считываниями. Из всех прочтений только 1,4% прочтений остались неаннотированными (рис. 2). Всего во всех пробах мы наблюдали 12 родов простейших. Polyplastron и Ophryoscolex преобладали над P-100 и P-60, в то время как P-40 почти полностью состоял из Isotricha (95.5%). Меньший фильтр P-10 имел смешанную популяцию из Dasytricha , Entodinium и Isotricha , а его фильтрат P-<10 почти исключительно содержал представителей Dasytricha (93,5%; рис. 2). Этот результат показывает, что, используя подход фильтрации, мы можем получить различные популяции простейших.

    РИСУНОК 2. Распределение простейших, полученное с помощью различных фильтров. Суммарный график с цветовой кодировкой, показывающий распределение простейших на уровне рода по фракциям разного размера.Таксономическое отнесение было выполнено с использованием базы данных, полученной от Kittelmann et al. (2015).

    Ампликонное секвенирование прокариотической рДНК 16S

    Секвенирование 16S рДНК дало 3 924 475 качественных прочтений, в среднем 45 354 ± 2748 прочтений на образец. Общее количество OTU, обнаруженных в результате анализа, достигло 12 615 на основе ≥97% идентичности последовательностей нуклеотидов между прочтениями. Используемые универсальные праймеры, захватывающие как бактерии, так и археи, позволили оценить количество прочтений в каждом домене из одного цикла секвенирования.Отнесение прочтений к бактериям и археям показало, что соотношение архей/бактерий во фракциях простейших было значительно выше по сравнению с соотношением свободноживущих фракций (ранговая сумма Уилкоксона, P <0,05; дополнительная фигура S2). Этот результат подтвердил результаты количественной ПЦР; однако пропорции, полученные в результате секвенирования ампликона, были значительно выше по сравнению с результатами ПЦР в реальном времени (дополнительная фигура S2). Результаты, полученные на фильтрах большего размера П-100, П-60, с 10% и 13% всего прокариотического сообщества имели самые высокие доли метаногенов.Образцы Р-40, Р-10 и Р-<10 имели относительную долю ∼6%, ∼5% и ∼4% соответственно. Свободноживущее микробное сообщество составляло 1,1% всего прокариотического сообщества, отнесенного к археям.

    Структура сообщества прокариот различных фракций простейших рубца

    Анализ альфа-разнообразия

    показал, что сообщество свободноживущих прокариот было значительно богаче по сравнению со всеми фракциями простейших. Это наблюдалось как по количеству обнаруженных OTU, так и по индексу Chao1.Кроме того, P-60, P-40 и P-10 имели более низкое видовое богатство по сравнению с P-100, P-<10 и свободноживущими фракциями ( P <0,05; рисунки 3A, B).

    РИСУНОК 3. Структура популяции прокариот по различным фракциям. (A) Богатство OTU (сходство ≥97%) и (B) Индекс Chao1 свободноживущих и ассоциированных с простейшими прокариотических сообществ. (C) Неметрическое многомерное шкалирование (NMDS) на основе матрицы подобия OTU, полученной с использованием индекса Брея-Кертиса.Каждая точка представляет собой отдельный образец, нанесенный на график в соответствии с их составом и численностью OTU. Большее расстояние между двумя точками свидетельствует о меньшем сходстве между составами прокариотических сообществ. Цветовое кодирование представляет различные оцениваемые фракции.

    Неметрическое многомерное масштабирование с использованием метрики несходства Брея-Кертиса выявило четкую кластеризацию между свободноживущим сообществом и сообществами, связанными с простейшими (рис. 3C и таблица 1). Кроме того, наблюдалась отчетливая и значительная кластеризация между различными сообществами, связанными с простейшими, полученными из фильтров разных размеров.Примечательно, что разница между сообществами увеличивалась с увеличением расстояния до размера фильтра (рис. 3C и таблица 1). Значительная группировка выборок по происхождению животного-хозяина могла наблюдаться во фракции свободноживущих коров, отобранных в пяти временных точках (ANOSIM, R = 0,68; P < 0,01), но такой дискриминации не наблюдалось. можно наблюдать в прокариотических сообществах, связанных с простейшими (дополнительная фигура S3A). Сообщество прокариот, ассоциированное с простейшими, также демонстрировало более высокую изменчивость со средним парным различием Брея-Кертиса между различными временными точками, равными 0.39, 0,42, 0,38, 0,43 и 0,39 для P-100, P-60, P-40, P-10 и P-<10 соответственно по сравнению со свободноживущим сообществом со средним попарным сходством 0,32 (критерий Стьюдента). t — тест; P <0,05; дополнительный рисунок S3B).

    ТАБЛИЦА 1. Анализ сходства микробных сообществ разных фракций.

    Сравнительный анализ ассоциированного с простейшими и свободноживущего метаногенного сообщества

    В свободноживущем сообществе семейство Methanomassiliicoccaceae было доминирующим таксоном, на долю которого приходилось в среднем 50 % всех прочтений метаногенов, за которым следовал Methanobrevibacter , в среднем 34 %, хотя можно увидеть большую изменчивость в пределах этот род между разными временными точками и хозяевами. Methanomirobium имел в среднем 11% в свободноживущем сообществе (дополнительный рисунок S4). В ассоциированных с простейшими метаногенных сообществах преобладали Methanobrevibacter ( Mbb. ) со средним значением от 50% до 80%, за которыми следовали Methanomassiliicoccaceae со средним значением от 13% до 39% и Methanomirobium в диапазоне от 0,94% до 7,4% по фракциям.

    Используя RIM-DB, базу данных, специально ориентированную на идентификацию и аннотацию метаногенных архей рубца, мы оценили распределение внутри таксономических групп, наблюдаемое в различных фракциях.OTU, которые имели высокое сходство (сходство OTU> 97%) с последовательностями из этой базы данных, были, таким образом, отнесены к нескольким различным кладам в каждом из наблюдаемых семейств или родов (Seedorf et al., 2014). Мбб. gottschalkii, Mbb. wolinii и Mbb. ruminantium представлял подавляющее большинство OTU из рода Methanobbrevibacter и демонстрировал значительные различия как между свободноживущими и ассоциированными с простейшими популяциями, так и между различными фракциями простейших (рис. 4).Фракции П-100 и П-60 характеризовались достоверно большей долей ОТЕ, связанных с Мбн. gottschalkii по сравнению со свободноживущей популяцией и другими фракциями, связанными с простейшими (ранговая сумма Уилкоксона, P <0,01; рис. 4). Напротив, OTU, связанные с Mbb. wolinii наблюдались в большей пропорции во фракции P-40, P-10 и P-<10 по сравнению с P-100, P-60 и свободноживущей фракцией (сумма рангов Уилкоксона, P <0.05). Мбб. ruminantium был в значительно более высокой доле во всех фракциях простейших (5,11% в среднем по всем фракциям, связанным с простейшими) по сравнению со свободноживущей популяцией (0,83%) (ранговая сумма Уилкоксона, P <0,05).

    РИСУНОК 4. Состав метаногенов в различных фракциях. Коробчатая диаграмма, представляющая таксономическое распределение метаногенов по различным фракциям. Таксоны определяются в соответствии с наименьшим таксономическим присвоением, полученным с использованием базы данных RIM-DB, и их соответствующая семейная или родовая принадлежность подчеркивается над каждым графиком. Прямоугольники представляют межквартильный диапазон (IQR) между первым и третьим квартилями (25-й и 75-й процентили соответственно), а горизонтальная линия внутри прямоугольника определяет медиану. Усы представляют самые низкие и самые высокие значения в пределах 1,5-кратного IQR из первого и третьего квартилей соответственно. Надписи над прямоугольниками обозначают скорректированную значимость Бенджамини-Хохберга для разных групп, при этом прямоугольники, не имеющие общей буквы, значительно различаются при P <0.05.

    Семейство Methanomassiliicoccaceae состояло из нескольких определенных подгрупп (Seedorf et al., 2014), которые, как и Methanobrevibacter , имели разные пропорции между фракциями. Доля OTU, связанных с Group_9, была значительно выше во фракции свободноживущих, составляя в среднем 21,13% от общего количества метаногенных OTU по сравнению с фракциями, связанными с простейшими (ранговая сумма Уилкоксона, P <0,05). Кроме того, в этой группе наблюдались разные пропорции между фракциями простейших, при этом P-100 и P-60 демонстрировали самую низкую пропорцию со средним значением 1. 07% и 3,3% соответственно, по сравнению со значительно более высокой долей во фракциях P-40, P-10 и P-<10, с 11%, 10,5% и 5,9% соответственно (ранговая сумма Уилкоксона, P < 0,05; рис. 4). Клада Group_8 имела более низкую долю в P-100 по сравнению со свободноживущей фракцией, но была выше во фракции P-40 ( P <0,05; сумма рангов Уилкоксона; рисунок 4). Methanomirobium mobile имел значительно более высокую долю во фракции свободноживущих животных, в среднем 11.86 % по сравнению с фракциями простейших P-100 и P-60 (1 % и 2,1 % соответственно; P < 0,05) и показал незначительно более низкую долю в P-40 (8,4 %; P = 0,29), P-10 (3,8%: P = 0,07) и P-<10 (3,6%; P = 0,09) фракции (рис. 4).

    Распределение бактерий среди свободноживущих и простейших фракций

    Во всех образцах наблюдалось в общей сложности 46 различных типов бактерий, среди которых 14 имели среднюю относительную численность выше 0.5% по крайней мере в одной из групп (рис. 5А).

    РИСУНОК 5. Распределение бактерий на уровне Phylum по фракциям. (A) Суммарный график с цветовой кодировкой, показывающий среднее распределение бактериального типа во фракциях свободноживущих и связанных с простейшими. (B) Коробчатые диаграммы, показывающие относительную численность наиболее распространенных типов, обнаруженных в различных фракциях. Надпись над прямоугольниками указывает на скорректированную значимость Бенджамини-Хохберга для разных групп, при этом прямоугольники, не имеющие общей буквы, значительно различаются при P <0.05.

    Bacteroidetes и Firmicutes были наиболее распространенными типами во всех образцах, что согласуется с предыдущими исследованиями микробиома рубца (Jami and Mizrahi, 2012; Henderson et al., 2015). Однако доля Bacteroidetes была значительно выше в свободноживущем сообществе, в среднем 62,8%, по сравнению с сообществами, связанными с простейшими, в которых она составляла в среднем 25% (ранговая сумма Уилкоксона, P <0,001; рисунок 5B). . Напротив, Firmicutes были доминирующим типом во всех фракциях простейших, на долю которых приходилось в среднем 52–63% по сравнению со средним показателем 24% в свободноживущем сообществе (ранговая сумма Уилкоксона, P < 0.001; по всем дробям). Другие типы, которые имели значительно различное соотношение между фракциями свободноживущих и простейших, включают Actinobacteria, Proteobacteria и Elusimicrobia, которые были выше во всех сообществах, связанных с простейшими (рис. 5B). Напротив, Verrucomicrobia имела более низкую долю в большинстве фракций, связанных с простейшими, по сравнению со фракцией свободноживущих, а TM7 был пропорционально выше в популяции свободноживущих животных по сравнению со всеми фракциями, связанными с простейшими (ранговая сумма Уилкоксона, P ). < 0.05). Как Actinobacteria, так и Fibrobacteres показали значительную разницу в соотношении между фракциями простейших. Fibrobacteres было уникально обогащено фракцией P-100 (сумма рангов Уилкоксона, P <0,01; рис. 5B), в то время как доля Actinobacteria была значительно выше во фракции P-10 и P-<10 по сравнению со всеми другими фракциями со средним значением 5,8. % и 6% соответственно (сумма рангов Уилкоксона, P <0,01).

    Далее мы изобразили 35 самых многочисленных семей из 315 семей, которые имели среднюю относительную численность не менее 0.5% хотя бы в одной из фракций (рис. 6).

    РИСУНОК 6. Тепловая карта и иерархическая кластеризация бактериального состава на уровне семейства в различных фракциях. Представлены логарифмически преобразованные данные о численности 35 наиболее распространенных таксонов на уровне семейства в различных фракциях. Каждая вертикальная дорожка соответствует образцу, а разные цвета под горизонтальной дендрограммой обозначают происхождение образца в разных фракциях. Закрашенные кружки рядом с вертикальной дендрограммой представляют скорректированную по FDR значимость между свободноживущими и каждой отдельной группой сообщества, ассоциированной с простейшими (ранговая сумма Уилкоксона, P < 0. 05, для каждой строки). Например, Clostridiales во свободноживущем сообществе находится в значительно иной пропорции по сравнению с P-100 и P-<10, но не P-60, P-40 и P-10. Серые квадраты внутри тепловой карты обозначают таксоны, которые не были обнаружены в образце. Таксоны, которые не могут быть отнесены к семейству, отображаются с использованием самого низкого таксономического уровня, который может быть им присвоен.

    Более высокие пропорции, наблюдаемые в пределах типа Firmicutes в фракциях, связанных с простейшими, в основном обусловлены присутствием семейства Lachnospiraceae.Это семейство оказалось в значительно более высокой доле во всех ассоциированных с простейшими сообществах, в среднем 12,7%, 25,4%, 32%, 28,9% и 24% для P-100, P-60, P-40, P- 10 и доли P-<10, соответственно, по сравнению с 3,75% в среднем в сообществе свободноживущих (ранговая сумма Уилкоксона; P <0,01, рис. 6).

    Prevotellaceae и его самый многочисленный род в рубце, Prevotella, , были в значительно меньшей пропорции по сравнению со свободноживущими во всех сообществах, связанных с простейшими ( P < 0. 001; Рисунки 6, 7 и дополнительная таблица S2). Другие значительно и постоянно недопредставленные таксоны в сообществах, связанных с простейшими, включали неопределенные роды Paraprevotellaceae, с 4,5% свободноживущих сообществ против ~0,8% сообществ, связанных с простейшими (ранговая сумма Уилкоксона; P <0,01, рисунок 7 и дополнительная таблица S2) и Семейство Bacteroidaceae BF311 (сумма рангов Уилкоксона; P <0,01, рисунок 7 и дополнительная таблица S2), оба принадлежат к типу Bacteroidetes (рисунок 7 и дополнительная таблица S2).Из типа Bacteroidetes семейство Bacteroidales S24-7 было в значительно большей пропорции в сообществах, связанных с простейшими, по сравнению со свободноживущими сообществами (сумма рангов Уилкоксона, P <0,001; рис. 6). Внутри филума Actinobacteria значительно более высокая доля Coriobacteriaceae наблюдалась в бактериальном сообществе, ассоциированном с простейшими (рис. 6, 7). Это семейство было значительно более многочисленным в P-10 и P-<10 по сравнению с другими фракциями простейших, в среднем 5. 6% и 5,2% соответственно (сумма рангов Уилкоксона, P <0,01; рисунок 7 и дополнительная таблица S2). Как видно из распределения по типам, род Fibrobacter был уникально обогащен фракцией P-100 по сравнению со всеми другими свободноживущими сообществами, связанными с простейшими (ранговая сумма Уилкоксона, P <0,01; рисунок 6 и дополнительная таблица S2). Мы дополнительно идентифицировали группу из нескольких таксонов, которые были обнаружены либо в низкой пропорции, либо не обнаружены в свободноживущем сообществе, но обогащены сообществами, ассоциированными с простейшими.К ним относятся Chitinophagaceae класса Sphingobacteria, Flavobacteriaceae (Flavobacteriia), Mycoplasmataceae (Mollicutes) и представители класса Alpha-proteobacteria, включая представителей отряда Rickettsiales (рис. 6, 7 и дополнительная таблица S2). В этих менее многочисленных типах мы наблюдали значительно более высокую долю Endomicrobia во всех сообществах, связанных с простейшими, достигая до 10% бактериальных сообществ во фракциях P-60 и P-40 (рисунок 7 и дополнительная таблица S2). Примечательно, что Endomicrobia является известным эндосимбионтом жгутиковых простейших в кишечнике термитов, где жгутиконосцы являются обязательным симбионтом и играют решающую роль в переваривании целлюлозы (Honigberg, 1970; Inoue et al., 1997).

    РИСУНОК 7. Таксоны, демонстрирующие самые высокие различия между свободноживущими и ассоциированными с простейшими сообществами. Таксоны, которые демонстрировали наибольшую разницу в относительной численности между свободноживущими и ассоциированными с простейшими сообществами.Показанные таксоны представлены в самой низкой таксономической принадлежности, которую можно было бы им присвоить, вплоть до уровня рода. Значения P над каждым отдельным графиком были получены с использованием теста Крускала-Уоллиса, с поправкой на множественные сравнения с использованием процедуры Бенджамини-Хохберга.

    Обсуждение

    Цель этого исследования состояла в том, чтобы идентифицировать и охарактеризовать прокариотические сообщества, связанные с различными популяциями инфузорий, обнаруженных в рубце крупного рогатого скота, и оценить, отличается ли их состав от свободноживущих сообществ. Результаты как секвенирования, так и ПЦР в реальном времени выявили более высокое соотношение метаногенов/бактерий в образцах, связанных с различными популяциями простейших, что подкрепляет растущее количество доказательств того, что между инфузориями рубца и метаногенами существует тесная функциональная связь (Finlay et al., 1994; Ushida et al. ., 1997; Ньюболд и др., 2015). Интересно, что более высокая пропорция соотношения археи/бактерии была обнаружена у более крупных видов простейших, что свидетельствует о дифференциальном тропизме к метаногенной популяции между различными видами простейших в рубце.В отличие от Belanche et al. (2014), которые не наблюдали различных пропорций метаногенов в сообществах, связанных с разными популяциями простейших у овец. Наблюдаемое несоответствие может быть связано с различиями в методологии, такими как разные животные, используемые для эксперимента, разное содержание животных, диета и время отбора проб, или праймеры, используемые для обнаружения метаногенов. Последний вариант также может быть ответственным за различные результаты, полученные в результате количественного определения ПЦР в реальном времени, и результаты секвенирования в текущем исследовании, поскольку ранее было показано, что использование различных праймеров приводит к значительным систематическим ошибкам при количественном определении и характеристике метаногенной популяции рубца (Tymensen and McAllister). , 2012).

    Анализ экологических особенностей прокариотических OTU (т. е. альфа- и бета-разнообразие) выявил существенные различия в общей структуре прокариотических сообществ, связанных с простейшими, по сравнению со свободноживущими сообществами. Эти результаты согласуются с ранее показанными различиями в структуре метаногенной популяции, связанной с простейшими, по сравнению со свободноживущей популяцией в рубце, и позволяют предположить, что эти структурные различия распространяются на все прокариотическое сообщество (Tymensen and McAllister, 2012; Tymensen et al. ., 2012; Беланш и др., 2014). В дополнение к наблюдаемым различиям между свободноживущими и связанными с простейшими прокариотическими сообществами, каждая фракция простейших также характеризовалась разным прокариотическим составом, поскольку прокариотические сообщества, полученные из фильтров разного размера, также группировались отдельно друг от друга. Это говорит о том, что ассоциация между видами простейших и окружающими их прокариотическими клетками может включать механизмы селективных взаимодействий.

    В соответствии с предыдущими наблюдениями, Methanobrevibacter был доминирующим родом в большинстве фракций простейших (Tymensen et al., 2012). Это повторяющееся наблюдение за ассоциацией Methanobrevibacter /протозоа, рода, в основном связанного с гидрогенотрофной активностью, еще раз подтверждает идею о том, что ассоциация метаногена/протозоа в рубце, вероятно, является следствием высокой способности простейших вырабатывать водород (Finlay et al., 1994). ; Ushida et al. , 1997; Tymensen et al., 2012; Newbold et al., 2015).

    Мы также наблюдали значительно отличающиеся пропорции Мбн. gottschalkii и Mbb.Wolinii между фракциями простейших. Несколько исследований связали высокие выбросы метана у крупного рогатого скота с более высоким содержанием Mbb. gottschalkii и другие представители SGMT ( Mbb. smithii , Mbb. gottschalkii , Mbb. millerae и Mbb. thaueri) метаногенная группа в рубце (Dani ). Это наблюдение в сочетании с различными пропорциями этого вида между различными популяциями простейших предполагает, что подмножество простейших может иметь большее участие в увеличении производства метана.Действительно, эта возможность ранее исследовалась в исследовании Belanche et al. (2015), которые показали, что голотриховые простейшие вносят больший вклад в эмиссию метана у овец. Подобно роду Methanobrevibacter , определенные клады, принадлежащие к семейству Methanomassiliicoccaceae, демонстрировали различные пропорции между различными сообществами, связанными с простейшими. Тем не менее, эти клады остаются ограниченными филогенетическим анализом в основном некультивируемых видов, и нет никакой дополнительной информации о конкретных геномных особенностях этих групп и их роли в экосистеме рубца (Seedorf et al., 2014).

    До сих пор лишь ограниченное число исследований было посвящено характеристике бактериального сообщества, ассоциированного с инфузориями рубца (Lloyd et al., 1996; Irbis and Ushida, 2004; Boeckaert et al., 2009; Wang et al., 2017). Наш анализ выявил широкие различия в составе между свободноживущим бактериальным сообществом и сообществом, ассоциированным с простейшими. Это можно наблюдать уже на уровне типов, где доли нескольких типов, таких как Firmicutes и Proteobacteria, были значительно выше в сообществах, связанных с простейшими.Преимущественная ассоциация между простейшими и определенными типами наблюдалась в недавнем исследовании по оценке филогенетической принадлежности бактерий, связанных с морскими и пресноводными инфузориями (Gong et al. , 2016). В этом исследовании авторы показали, что таксоны, принадлежащие к протеобактериям, сильно обогащены простейшими. Авторы предположили, что эта избирательная ассоциация связана с двумя системами секреции белков, более заметными у гамма- и альфа-протеобактерий, которые могут играть важную роль в продвижении ассоциации морских простейших и бактерий.Таким образом, за избирательную ассоциацию с простейшими могут быть ответственны специфические геномные особенности, более общие для конкретных типов бактерий. Такие геномные признаки также наблюдались в контексте ассоциации метаногенов/простейших в рубце (Ng et al., 2016). Недавнее исследование показало, что геномы нескольких видов Methanobrevibacter , таких как Mbb. ruminantium , содержат адгезиноподобные белки с высоким сродством к нескольким видам простейших (Ng et al., 2016), что может объяснить наблюдаемый более высокий тропизм этого рода к ассоциации с простейшими.

    Семейства Lachnospiraceae и Ruminococcaceae были значительно обогащены бактериальными сообществами, ассоциированными с простейшими, по сравнению со свободноживущими сообществами.

    Идентичность и роль большинства представителей Lachnospiraceae и Ruminococcaceae в рубце остаются неясными, однако несколько недавних исследований по оценке редуктивного ацетогенеза в рубце показали, что как Lachnospiraceae, так и Ruminococcaceae занимают видное место в питательных средах, обогащенных гомоацетогенными функциями (Gagen et al., 2010, 2014, 2015; Ян и др., 2016). Подобно метаногенам, бактерии, способные к восстановительному ацетогенезу из CO 2 и H 2 в качестве донора электронов для производства ацетата, могут найти выгодную локальную среду для простейших. Считается, что гомоацетогены редко встречаются в рубце, поскольку метаногены проигрывают им (Cord-Ruwisch et al., 1988; Morvan et al., 1994). Однако можно наблюдать, как ацетогены и другие бактерии, утилизирующие водород, колонизируют рубец новорожденных животных и присутствуют в изобилии во время начального развития рубца (Fonty et al., 1987, 2007; Морван и др., 1994; Фридман и др., 2017). Усилением возможности преобладания ацетогенов в ассоциированных с простейшими сообществах является обогащение таксонов, отнесенных к родам Syntrophococcus (сходство OTU >93,8% с ближайшим изолятом Syntrophococcus sucromutans ) и Blautia (сходство OTU >95%). . S. sucromutans , единственный культивируемый представитель рода Syntrophococcus , является известным ацетогеном рубца, в то время как Blautia имеет несколько представителей, которые, как известно, находятся в рубце и идентифицированы как ацетогены (Krumholz and Bryant, 1986; Doré and Bryant, 1990). ; Берналье и др., 1996; Шиль-Бенгельсдорф и Дюрре, 2012). Таким образом, наши результаты показывают, что простейшие могут быть не только привлекательной средой для гидрогенотрофных видов метаногенов, но и содержать более широкий спектр бактерий, способных выполнять различные гидрогенотрофные функции. Такие типы взаимодействия не являются беспрецедентными и недавно были предложены для простейших в кишечнике термитов, питающихся древесиной. Было показано, что в кишечнике термитов геном одного симбионта, связанного с простейшими, содержит путь Вуда-Льюнгдала, в то время как другой симбионт кодирует гены, связанные с восстановлением сульфатов/фумаратов, другой гидрогенотрофной активностью, обнаруженной в рубце (Ikeda-Ohtsubo et al., 2016; Кувахара и др., 2017).

    В дополнение к различной численности общих таксонов между свободноживущими и ассоциированными с простейшими фракциями. Мы наблюдали несколько бактериальных таксонов, которые не были обнаружены или появлялись в небольшом количестве в свободноживущих образцах и были обогащены фракциями, связанными с простейшими. К ним относятся линии протеобактерий, такие как Rickettsiales и другие неопределенные альфа-протеобактерии. Irbis и Ushida (2004) сделали аналогичное наблюдение в исследовании, в котором простейшие, инкубированные в течение 48 часов с антибиотиками, привели к обогащению несколькими видами Proteobacteria, один из которых ранее был идентифицирован как известный симбионт пресноводной инфузории Euplotes aediculatus . .Другие бактериальные таксоны, встречающиеся исключительно в сообществе простейших, включают членов Sphingobacteria и Flavobacterium . Интересно, что ранее было показано, что члены этих таксонов участвуют в симбиотических отношениях с эктопаразитической инфузорией Ichthyophthirius multifiliis (Sun et al., 2009).

    Наши анализы выявили высокую распространенность OTU, принадлежащих к классу Endomicrobia, которые могут достигать до 10% бактериальных сообществ, ассоциированных с простейшими.В нескольких исследованиях были идентифицированы представители этого класса, участвующие в облигатных эндосимбиотических отношениях с жгутиковыми простейшими у термитов, питающихся древесиной (Ikeda-Ohtsubo et al., 2010; Zheng and Brune, 2015; Mikaelyan et al., 2017). Примечательно, что эндомикробии иногда обнаруживаются в попытках глубокого секвенирования, характеризующих микробиом передней и задней кишки животных (Hook et al., 2011; Jami et al., 2013; Mach et al., 2017). Однако ограниченная информация об этих таксонах и тот факт, что они обычно представляют собой небольшую долю наблюдаемого разнообразия в рубце, обычно приводят к тому, что этот тип в значительной степени игнорируется.Икеда-Оцубо и др. (2010) предположили, основываясь на повторяемости этой линии в различных системах кишечника, включая рубец, что они могут представлять несимбиотические виды, филогенетически связанные с теми, которые обнаружены у простейших термитов. Однако высокая доля, наблюдаемая в бактериальных сообществах, связанных с простейшими, предполагает, что ассоциация между Endomicrobia и простейшими не ограничивается кишечником термитов и может быть широко распространена в различных средах, включая рубец.

    Заключение

    Идентичность и роль прокариотических микроорганизмов, связанных с простейшими, остается в значительной степени неясной.Насколько нам известно, это первое всестороннее исследование общей популяции прокариот, связанное с различными популяциями инфузорий простейших, направленное на характеристику структуры как бактериальных, так и архейных таксонов. Простейшие питаются прокариотическими членами микробиома, и поэтому возможно, что часть наблюдаемых прокариотических популяций служит этой цели (Williams and Coleman, 2012). Сложность получения чистых культур простейших препятствует возможности изучения специфических взаимодействий с ассоциированными прокариотическими видами.

    Специфичность каждого прокариотического сообщества в отношении различных изолированных фракций простейших, пропорциональное доминирование нескольких таксонов и наблюдаемое обогащение бактериями, ранее связанными с симбиозом простейших в других средах, включая систему кишечника термитов, разлагающих целлюлозу, позволяют предположить, что прокариотическое сообщество могло иметь большое разнообразие функциональных взаимодействий, сохраняющихся в различных средах, с соседней популяцией инфузорий.

    Вклад авторов

    EJ и BL задумали и провели эксперименты и проанализировали данные.EJ написал рукопись.

    Финансирование

    Это исследование было поддержано грантами Фонда Израильского совета по молочным продуктам (грант № 362-0524/25) и Министерства сельского хозяйства и развития сельских районов Израиля (грант № 362-0542).

    Заявление о конфликте интересов

    Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

    Благодарности

    Мы хотим поблагодарить Таниту Вейн за ее полезное и критическое прочтение рукописи.

    Дополнительный материал

    Дополнительный материал к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/articles/10.3389/fmicb.2018.02526/full#supplementary-material

    .

    Сноски

    1. http://www.earthmicrobiome.org/
    2. http://greengenes.lbl.gov

    Каталожные номера

    Беланш А., де ла Фуэнте Г. и Ньюболд С. Дж. (2014). Изучение метаногенных сообществ, связанных с различными популяциями простейших рубца. FEMS микробиол. Экол. 90, 663–677. дои: 10.1111/1574-6941.12423

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Беланш А. , де ла Фуэнте Г. и Ньюболд С. Дж. (2015). Влияние постепенной инокуляции овец без фауны голотричными простейшими и общей фауной на ферментацию рубца, микробное разнообразие и метан. FEMS микробиол. 91:fiu026.

    Реферат PubMed | Академия Google

    Бенджамини Ю. и Хохберг Ю.(1995). Управление частотой ложных открытий: практичный и мощный подход к множественному тестированию. JR Stat. соц. сер. Б Стат. Методол. 57, 289–300.

    Академия Google

    Берналье А., Виллемс А., Леклерк М., Роше В. и Коллинз М. Д. (1996). Ruminococcus hydronotrophicus sp. nov., a new H 2 /CO 2 — утилизирующие ацетогенные бактерии, выделенные из фекалий человека. Арх. микробиол. 166, 176–183. дои: 10.1007/s002030050373

    Полнотекстовая перекрестная ссылка | Академия Google

    Boeckaert, C., Morgavi, D.P., Jouany, J.-P., Maignien, L., Boon, N., and Fievez, V. (2009). Роль простейших Isotricha prostoma , жидкостных и твердых бактерий в биогидрировании линолевой кислоты в рубце. Животное 3, 961–971. дои: 10.1017/S17517311085

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Капорасо, Дж. Г., Кучински, Дж., Стомбах, Дж., Bittinger, K., Bushman, F.D., Costello, E.K., et al. (2011). QIIME позволяет анализировать данные секвенирования с высокой пропускной способностью. Нац. Методы 7, 335–336. doi: 10.1038/nmeth.f.303

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Корд-Рувиш, Р., Зейтц, Х.-Дж., и Конрад, Р. (1988). Способность гидрогенотрофных анаэробных бактерий конкурировать за следы водорода зависит от окислительно-восстановительного потенциала конечного акцептора электронов. Арх. микробиол. 149, 350–357. дои: 10.1007/BF00411655

    Полнотекстовая перекрестная ссылка | Академия Google

    Danielsson, R., Dicksved, J., Sun, L., Gonda, H., Müller, B., Schnürer, A., et al. (2017). Производство метана у молочных коров коррелирует с метаногенностью рубца и структурой бактериального сообщества. Перед. микробиол. 8:226. doi: 10.3389/fmicb.2017.00226

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Даниэльссон Р., Шнюрер А. и Артурсон В.(2012). Метаногенная популяция и продукция Ch5 у шведских молочных коров, получавших разное количество корма. Заяв. Окружающая среда. микробиол. 78, 6172–6179. doi: 10.1128/AEM.00675-12

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Доре, Дж., и Брайант, член парламента (1990). Метаболизм одноуглеродных соединений ацетогеном рубца Syntrophococcus sucromutans . Заяв. Окружающая среда. микробиол. 56, 984–989.

    Реферат PubMed | Академия Google

    Дзиаллас, К., Allgaier, M., Monaghan, M.T., and Grossart, H.-P. (2012). Действовать сообща — последствия симбиозов у ​​водных инфузорий. Перед. микробиол. 3:288. doi: 10.3389/fmicb.2012.00288

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Эдгар, Р. К., Хаас, Б. Дж., Клементе, Дж. К., Айва, К., и Найт, Р. (2011). UCHIME повышает чувствительность и скорость обнаружения химер. Биоинформатика 27, 2194–2200. doi: 10.1093/биоинформатика/btr381

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Фенхель, Т.и Финли, Б.Дж. (1992). Производство метана и водорода анаэробными инфузориями, содержащими симбиотические метаногены. Арх. микробиол. 157, 475–480.

    Академия Google

    Финли, Б.Дж., Эстебан, Г., Кларк, К.Дж., Уильямс, А.Г., Эмбли, Т.М., и Хирт, Р.П. (1994). Некоторые инфузории рубца имеют эндосимбиотические метаногены. FEMS микробиол. лат. 117, 157–161. doi: 10.1111/j.1574-6968.1994.tb06758.x

    Полнотекстовая перекрестная ссылка | Академия Google

    Фонти, Г., Gouet, P., Jouany, J.-P., and Senaud, J. (1987). Установление микрофлоры и анаэробных грибов в рубце ягнят. J. Gen. Microbiol. 133, 1835–1843 гг.

    Академия Google

    Фонти Г. , Джоблин К., Чаваро М., Ру Р., Нейлор Г. и Михалон Ф. (2007). Становление и развитие рубцовых гидрогенотрофов у безметаногенных ягнят. Заяв. Окружающая среда. микробиол. 73, 6391–6403. doi: 10.1128/AEM.00181-07

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Фридман, Н., Джами, Э., и Мизрахи, И. (2017). Композиционная и функциональная динамика метаногенного сообщества рубца крупного рогатого скота на разных стадиях развития. Окружающая среда. микробиол. 19, 3365–3373. дои: 10.1111/1462-2920.13846

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Гаген, Э.Дж., Денман, С.Э., Падманабха, Дж., Задбуке, С., Аль Джассим, Р., Моррисон, М., и др. (2010). Функциональный генный анализ предполагает наличие различных популяций ацетогена в рубце крупного рогатого скота и преджелудке валлаби таммара. Заяв. Окружающая среда. микробиол. 76, 7785–7795. doi: 10.1128/AEM.01679-10

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Гаген, Э. Дж., Падманабха, Дж., Денман, С. Э., и МакСвини, К. С. (2015). Обогащение гидрогенотрофной культуры выявляет рубец Lachnospiraceae и Ruminococcaceae acetogens и чувствительных к водороду Bacteroidetes пастбищного скота. FEMS микробиол. лат. 362:fnv104. doi: 10.1093/femsle/fnv104

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Гаген, Э.J., Wang, J., Padmanabha, J., Liu, J., de Carvalho, I.P.C., Liu, J., et al. (2014). Исследование нового ацетогена, выделенного из обогащения преджелудка таммарского валлаби. ВМС микробиол. 14:314. doi: 10.1186/s12866-014-0314-3

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Гаст, Р. Дж., Сандерс, Р. В., и Кэрон, Д. А. (2009). Экологические стратегии протистов и их симбиотические отношения с прокариотическими микробами. Тенденции микробиол. 17, 563–569. doi: 10.1016/j.tim.2009.09.001

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Гонг Дж. , Цин Ю., Цзоу С., Фу Р., Су Л., Чжан Х. и др. (2016). Ассоциации протист-бактерий: гаммапротеобактерии и альфапротеобактерии преобладают как устойчивые к пищеварению бактерии у реснитчатых простейших. Перед. микробиол. 7:498. doi: 10.3389/fmicb.2016.00498

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Герц, Х.-Д. (2006). «Симбиотические ассоциации между инфузориями и прокариотами», в Прокариоты: симбиотические ассоциации, биотехнология, прикладная микробиология , том. 1, ред. М. Дворкин, С. Фальков, Э. Розенберг, К.-Х. Шлейфер и Э. Стакебрандт (Нью-Йорк, штат Нью-Йорк: Springer), 364–402.

    Академия Google

    Хакштейн, Дж. Х., и Фогельс, Г. Д. (1997). Эндосимбиотические взаимодействия у анаэробных простейших. Антони Ван Левенгук 71, 151–158. дои: 10.1023/A:1000154526395

    Полнотекстовая перекрестная ссылка | Академия Google

    Молоток,Ø., Харпер, Д.А.Т., и Райан, П.Д. (2001). ПРОШЛОЕ: пакет программного обеспечения палеонтологической статистики для обучения и анализа данных. Палеонтол. Электроника 4:9.

    Академия Google

    Хендерсон, Г., Кокс, Ф., Ганеш, С., Йонкер, А., Янг, В., сотрудники Global Rumen Census, et al. (2015). Состав микробного сообщества рубца варьируется в зависимости от диеты и хозяина, но основной микробиом встречается в широком географическом диапазоне. науч. Реп. 5:14567. дои: 10.1038/srep14567

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Хонигберг, М.Б. (1970). «Простейшие, связанные с термитами, и их роль в пищеварении», в Biology of Termites , vol. 2, ред. К. Кришна и Ф. М. Визнер (Нью-Йорк, штат Нью-Йорк: Academic Press), 1–36.

    Академия Google

    Хук, С. Э., Стил, М. А., Нортвуд, К. С., Дейкстра, Дж., Франс, Дж., Райт, А.-Д. Г. и др. (2011). Влияние адаптации и восстановления подострого ацидоза рубца (SARA) на плотность и разнообразие бактерий в рубце молочных коров. FEMS микробиол.Экол. 78, 275–284. doi: 10.1111/j.1574-6941. 2011.01154.x

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Huws, S.A., Lee, M.R.F., Kingston-Smith, A.H., Kim, E.J., Scott, M.B., Tweed, J.K.S., et al. (2012). Вклад протозоев рубца в дуоденальный поток жирных кислот после кормления бычков кормами, различающимися по содержанию хлоропластов. Бр. Дж. Нутр. 108, 2207–2214. дои: 10.1017/S0007114512000335

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Иино, Т., Tamaki, H., Tamazawa, S., Ueno, Y., Okuma, M., Suzuki, K.-I., et al. (2013). Candidatus Methanogranum caenicola : новый метаноген из анаэробного сброженного ила и предложение Methanomassiliicoccaceae fam . ноябрь и Methanomassiliicoccales ord. nov., для метаногенной линии класса thermoplasmata. Окружающая среда микробов. 28, 244–250. дои: 10.1264/jsme2.ME12189

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Икеда-Оцубо, В. , Faivre, N., and Brune, A. (2010). Предположительно свободноживущие « Endomicrobia » — предки внутриклеточных симбионтов жгутиконосцев кишечника термитов? Окружающая среда. микробиол. 2, 554–559. doi: 10.1111/j.1758-2229.2009.00124.x

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Икеда-Оцубо, В., Штрассерт, Дж. Ф. Х., Келер, Т., Микаелян, А., Грегор, И., Макхарди, А. С., и соавт. (2016). Candidatus adiutrix intracellularis, эндосимбионт кишечных жгутиконосцев термитов, является первым представителем ветвистых ветвей дельтапротеобактерий и предполагаемым гомоацетогеном. Окружающая среда. микробиол. 18, 2548–2564. дои: 10.1111/1462-2920.13234

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Иноуэ Т., Мурашима К., Адзума Дж.-И., Сугимото А. и Слейтор М. (1997). Утилизация целлюлозы и ксилана низшим термитом Reticulitermes speratus . J. Физиология насекомых. 43, 235–242. doi: 10.1016/S0022-1910(96)00097-2

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Ирбис, с.и Ушида, К. (2004). Выявление метаногенов и протеобактерий из единичной клетки инфузорий рубца. J. Gen. Appl. микробиол. 50, 203–212. doi: 10.2323/jgam.50.203

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Kittelmann, S., Devente, S.R., Kirk, M.R., Seedorf, H., Dehority, B.A., and Janssen, P.H. (2015). Филогения кишечных инфузорий, включая Charonina ventriculi , и сравнение микроскопии и пиросеквенирования гена 18S рРНК для анализа структуры сообщества инфузорий рубца. Заяв. Окружающая среда. микробиол. 81, 2433–2444. doi: 10.1128/AEM.03697-14

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Крамхольц, Л.Р., и Брайант, М.П. (1986). Syntrophococcus sucromutans sp. ноябрь ген. ноябрь использует углеводы в качестве доноров электронов и формиат, метоксимонобензоиды или Methanobrevibacter в качестве систем акцепторов электронов. Арх. микробиол. 143, 313–318. дои: 10.1007/BF00412795

    Полнотекстовая перекрестная ссылка | Академия Google

    Кувахара, Х., Юки М., Изава К., Окума М. и Хонго Ю. (2017). Геном «Ca. Desulfovibrio trichonymphae», бактерия, окисляющая h3, в трехчастной симбиотической системе внутри клетки протистов в кишечнике термитов. ISME J. 11, 766–776. doi: 10.1038/ismej.2016.143

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Ллойд Д., Уильямс А. Г., Аманн Р., Хейс А. Дж., Даррант Л. и Ральфс Дж. Р. (1996). Внутриклеточные прокариоты в рубце реснитчатых простейших: обнаружение с помощью конфокальной лазерной сканирующей микроскопии после гибридизации in situ с флуоресцентными зондами 16S рРНК. евро. Дж. Протистол. 32, 523–531. doi: 10.1016/S0932-4739(96)80011-3

    Полнотекстовая перекрестная ссылка | Академия Google

    Мах, Н., Фури, А., Киттельманн, С., Рейнер, Ф., Морольдо, М., Баллестер, М., и др. (2017). Влияние методов отъема на состав микробиоты кишечника и физиологию лошади. Перед. Физиол. 8:535. doi: 10.3389/fphys.2017.00535

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Мальмутуге, Н., и Гуан, Л.Л. (2017). Понимание взаимодействия хозяин-микроб в рубце: поиск наилучшей возможности для манипулирования микробиотой. Дж. Аним. науч. Биотехнолог. 8:8. doi: 10.1186/s40104-016-0135-3

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Микаелян, А., Томпсон, С.Л., Меузер, К., Чжэн, Х., Рани, П., Пларре, Р., и соавт. (2017). Филогенетический анализ эндомикроб с высоким разрешением выявляет множественные приобретения эндосимбиотических линий жгутиконосцами кишечника термитов. Окружающая среда. микробиол. 9, 477–483. дои: 10.1111/1758-2229.12565

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Montagnes, D.J.S., Barbosa, A.B., Boenigk, J. , Davidson, K., Jurgens, K., Macek, M., et al. (2008). Избирательное пищевое поведение основных свободноживущих простейших: направления для дальнейшего изучения. Аква. микроб. Экол. 53, 83–98. дои: 10.3354/ame01229

    Полнотекстовая перекрестная ссылка | Академия Google

    Морван Б., Доре Дж., Rieu-Lesme, F., Foucat, L., Fonty, G., и Gouet, P. (1994). Создание водородоутилизирующих бактерий в рубце новорожденного ягненка. FEMS микробиол. лат. 117, 249–256. doi: 10.1111/j.1574-6968.1994.tb06775.x

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Ньюболд, С. Дж., де ла Фуэнте, Г., Беланче, А., Рамос-Моралес, Э., и Макьюэн, Н. Р. (2015). Роль инфузорий простейших в рубце. Перед. микробиол. 6:1313. doi: 10.3389/fmicb.2015.01313

    Полнотекстовая перекрестная ссылка | Академия Google

    Ньюболд, С. Дж., Лассалас, Б., и Жуани, Дж. П. (1995). Важность метаногенов, связанных с реснитчатыми простейшими, в производстве метана в рубце in vitro. Письмо. заявл. микробиол. 21, 230–234. doi: 10.1111/j.1472-765X.1995.tb01048.x

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Ng, F., Kittelmann, S., Patchett, M.L., Attwood, G.T., Janssen, P.H., Rakonjac, J., et al.(2016). Адгезин из утилизирующего водород метаногена рубца Methanobrevibacter ruminantium M1 связывает широкий спектр водородпродуцирующих микроорганизмов. Окружающая среда. микробиол. 18, 3010–3021. дои: 10.1111/1462-2920.13155

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Окума М., Нода С., Хаттори С., Иида Т., Юки М., Старнс Д. и др. (2015). Ацетогенез из H 2 плюс CO 2 и фиксация азота эндосимбиотической спирохетой термитно-кишечного целлюлозолитического протиста. Проц. Натл. акад. науч. США 112, 10224–10230. doi: 10.1073/pnas.1423979112

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Пол, К. , Ноно, Дж. О., Микульски, Л., и Брюн, А. (2012). «Methanoplasmatales», родственные Thermoplasmatales археи в кишечнике термитов и других средах, представляют собой метаногены седьмого порядка. Заяв. Окружающая среда. микробиол. 78, 8245–8253. doi: 10.1128/AEM.02193-12

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Пол, Р.Г., Уильямс А.Г. и Батлер Р.Д. (1990). Гидрогеносомы в рубце энтодиниоморфных инфузорий Polyplastron multivesiculatum . J. Gen. Microbiol. 136, 1981–1989 гг. дои: 10.1099/00221287-136-10-1981

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Плонер, А. (2006). Heatplus: тепловая карта, отображающая ковариаты и раскрашивающие кластеры . R Версия пакета 240. Берлингтон, Массачусетс: ScienceOpen, Inc.

    Академия Google

    Ранилья, М.Дж., Жуани, Дж.-П., и Моргави, Д.П. (2007). Производство метана и деградация субстрата микробными сообществами рубца, содержащими отдельные виды простейших, in vitro. Письмо. заявл. микробиол. 45, 675–680. doi: 10.1111/j.1472-765X.2007.02251.x

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Зеедорф, Х., Киттельманн, С., Хендерсон, Г., и Янссен, П. Х. (2014). RIM-DB: таксономическая основа для анализа структуры сообщества метаногенных архей из рубца и других кишечных сред. PeerJ 2:e494. doi: 10.7717/peerj.494

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Стивенсон Д.М. и Веймер П.Дж. (2007). Доминирование Prevotella и низкая численность классических видов рубцовых бактерий в рубце крупного рогатого скота выявлены с помощью относительного количественного определения методом ПЦР в реальном времени. Заяв. микробиол. Биотехнолог. 75, 165–174. doi: 10.1007/s00253-006-0802-y

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Вс, Х.Y., Noe, J., Barber, J., Coyne, R.S., Cassidy-Hanley, D., Clark, T.G. , et al. (2009). Эндосимбиотические бактерии у паразитической инфузории Ichthyophthirius multifiliis . Заяв. Окружающая среда. микробиол. 75, 7445–7452. doi: 10.1128/AEM.00850-09

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Тай В., Карпентер К. Дж., Вебер П. К., Налепа К. А., Перлман С. Дж. и Килинг П. Дж. (2016). Эволюция генома и азотфиксация у бактериальных эктосимбионтов протистов, обитающих у древесных тараканов. Заяв. Окружающая среда. микробиол. 82, 4682–4695. doi: 10.1128/AEM.00611-16

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Tapio, I., Shingfield, K.J., McKain, N., Bonin, A., Fischer, D., Bayat, A.R., et al. (2016). Пероральные образцы как неинвазивные заменители для оценки состава микробного сообщества рубца. PLoS One 11:e0151220. doi: 10.1371/journal.pone.0151220

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Тапио, И. , Снеллинг Т.Дж., Строцци Ф. и Уоллес Р.Дж. (2017). Рубцовый микробиом связан с выбросами метана жвачным скотом. Дж. Аним. науч. Биотехнолог. 8:7. doi: 10.1186/s40104-017-0141-0

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Tymensen, L.D., Beauchemin, K.A., and McAllister, T.A. (2012). Структуры свободноживущих и связанных с простейшими метаногенных сообществ в рубце крупного рогатого скота различаются по данным сравнительного анализа генов 16S рРНК и mcrA. Микробиология 158, 1808–1817. doi: 10.1099/мик.0.057984-0

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Тайменсен, Л. Д., и Макаллистер, Т. А. (2012). Анализ структуры сообщества метаногенов, ассоциированных с простейшими рубца, выявил предвзятость в универсальных архейных праймерах. Заяв. Окружающая среда. микробиол. 78, 4051–4056. doi: 10.1128/AEM.07994-11

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Ушида, К. , Ньюболд, К.Ж. и Жуани Ж.-П. (1997). Межвидовой перенос водорода между инфузориями рубца Polyplastron multivesiculatum и Methanosarcina barkeri . J. Gen. Appl. микробиол. 43, 129–131. doi: 10.2323/jgam.43.129

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Ваннини К., Петрони Г., Шена А., Верни Ф. и Розати Г. (2003). Устоявшиеся мутуалистические ассоциации между инфузориями и прокариотами могут быть более распространенными и разнообразными, чем предполагалось до сих пор. евро. Дж. Протистол. 39, 481–485. дои: 10.1078/0932-4739-00024

    Полнотекстовая перекрестная ссылка | Академия Google

    Уоллес, Р. Дж., Снеллинг, Т. Дж., Маккартни, К. А., Тапио, И., и Строцци, Ф. (2017). Применение методов метаомики для понимания выбросов парниковых газов в результате метаболизма в рубце. Жен. Сел. Эвол. 49:9. doi: 10.1186/s12711-017-0285-6

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Уолтер, Дж. , Tannock, G.W., Tilsala-Timisjarvi, A., Rodtong, S., Loach, D.M., Munro, K., et al. (2000). Обнаружение и идентификация желудочно-кишечных видов Lactobacillus с использованием денатурирующего градиентного гель-электрофореза и видоспецифичных праймеров для ПЦР. Заяв. Окружающая среда. микробиол. 66, 297–303. doi: 10.1128/AEM.66.1.297-303.2000

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Ван, З., Элеквачи, К.О., Цзяо, Дж., Ван, М., Тан, С., Чжоу, К., и другие. (2017). Исследование и манипулирование метаболически активным составом сообщества метаногенов во время развития рубца у черных коз. науч. Респ. 7:422. doi: 10.1038/s41598-017-00500-5

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Whitman, W.B., Rainey, F., Kämpfer, P., Trujillo, M., Chun, J., DeVos, P., et al. (2015). «Methanomassiliicoccales», в Bergey’s Manual of Systematics of Archaea and Bacteria , eds W. B. Whitman et al.(Чичестер: John Wiley & Sons, Ltd), 1–2. дои: 10.1002/9781118960608

    Полнотекстовая перекрестная ссылка | Академия Google

    Уильямс, А. Г., и Коулман, Г. С. (2012). Простейшие рубца. Берлин: Springer Science & Business Media.

    Академия Google

    Ямада К., Камагата Ю. и Накамура К. (1997). Влияние эндосимбиотических метаногенов на рост и метаболический профиль анаэробной свободноживущей инфузории Trimyema pressum . FEMS микробиол. лат. 149, 129–132. doi: 10.1111/j.1574-6968.1997.tb10319.x

    Полнотекстовая перекрестная ссылка | Академия Google

    Ян, К., Ми, Л., Ху, X., Лю, Дж., и Ван, Дж. (2016). Исследование выбора хозяина популяции ацетогена слепой кишки у кроликов после отъема. PLoS One 11:e0158768. doi: 10.1371/journal.pone.0158768

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Юань, Дж. С., Рид, А., Чен, Ф., и Стюарт, К.Н. (2006). Статистический анализ данных ПЦР в реальном времени. Биоинформатика BMC 7:85.

    Академия Google

    Чжэн, Х., и Брюн, А. (2015). Полная последовательность генома endomicrobium proavitum, свободноживущего родственника внутриклеточных симбионтов жгутиконосцев кишечника термитов (Phylum Elusimicrobia). Объявление генома. 3:e00679-15. doi: 10.1128/genomeA.00679-15

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Чжоу, М., Эрнандес-Санабриа, Э.и Гуань Л.Л. (2010). Характеристика изменчивости метаногенных сообществ рубца при различных диетических условиях и условиях эффективности кормления хозяина, как определено с помощью анализа ПЦР-денатурирующего градиентного гель-электрофореза. Заяв. Окружающая среда. микробиол. 76, 3776–3786. doi: 10.1128/AEM.00010-10

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Кишечные простейшие паразиты — MediaLab, Inc.

    Дополнительная информация

    Уровень обучения : от базового до среднего

    Предполагаемая аудитория : Медицинские лаборанты, медицинские лаборанты, резиденты патологии, студенты MLS и другой медицинский персонал, который интересуется этой темой.

    Информация об авторе: Маргарет Рейнхарт, MS, MT (ASCP) — старший преподаватель биологических наук в Университете наук в Филадельфии, штат Пенсильвания, где она преподает гематологию, клиническую иммунологию, паразитологию и другие смежные курсы. Она также является адъюнкт-инструктором по гематологии в больнице Пенсильвании, Филадельфия, штат Пенсильвания. Она была директором программы MLS в Университете наук в течение 30 лет. Она имеет степень магистра биологии и управления здравоохранением.

    Информация рецензента:     

    Дайан М. Валентин, MS, MT(ASCP)MB – г-жа Валентин, выпускница Университета наук в Филадельфии. Г-жа Валентин — выпускница Университета наук в Филадельфии (MT ’99), которая с момента окончания учебы работает медицинским лаборантом. Она также получила степень магистра наук в области биомедицинской информатики со специализацией в области биоинформатики в Университете Рутгерса и сертификат в области молекулярной лабораторной диагностики Университета штата Мичиган. Она имеет два сертификата Американского общества клинической патологии (ASCP): медицинский технолог и технолог в области молекулярной биологии.

    Рори Хушка, M. Ed., MT (ASCP), имеет более чем 20-летний опыт работы в качестве медицинского технолога, технического руководителя, профессора и менеджера. Он является бывшим директором программ клинических лабораторных исследований и медицинских лаборантов в Бруклинском колледже. В настоящее время он является программным директором в MediaLab, Inc. Рори имеет степень бакалавра медицинских технологий Университета штата Северная Дакота и степень магистра в области управления образованием.

    Тип простейших: питание и паразитизм

     

    ПИТАНИЕ ПРОСТЕЙШИХ

    Простейшие получают питание разными способами. Некоторые синтезируют свою собственную пищу, другие синтезируют ее с помощью водорослей, живущих в их цитоплазме, а третьи захватывают пищу. Некоторые простейшие ведут паразитический образ жизни, обычно не причиняя вреда своим хозяевам или причиняя очень мало вреда, но иногда вызывая серьезные заболевания.

    У простейших встречаются все типы питания, а именно голофитное питание, голозойное питание, сапрозойное питание, миксотрофное питание и паразитарное питание.Их режимы питания следующие:

    Голофитное питание: Фитофлагелляты обладают хлоропластами и хроматофорами для синтеза пищи путем фотосинтеза. В качестве сырья они используют солнечный свет, углекислый газ и воду. Этот способ самокормления называется автотрофной фототрофией. Синтезированный сахар декстрозы парамилон характерен для эвгленоидных жгутиконосцев.

    Голозойское питание: Большинство простейших получают питание, поглощая другие организмы.Такой способ питания называется голозойным. Он включает в себя развитие органелл для захвата пищи, проглатывания, пищеварения, ассимиляции и выделения непереваренных пищевых материалов. Свою пищу они захватывают жгутиками, псевдоподиями и трихитами.

    Некоторые используют аксоподии, ретикулоподии и щупальца, чтобы тянуть добычу, оказавшуюся в пределах их досягаемости. У инфузорий ресничный ротовой аппарат хорошо развит для захвата пищи и продвижения ее в сторону рта или цитосомы, а затем проталкивания ее в цитофаринкс.

    Пиноцитоз: Этот метод, также называемый выпивкой клеток, включает прием жидкой пищи путем инвагинации через поверхность тела. На некоторых участках тела образуются каналы пиноцитоза, в которые попадает жидкость из окружающей среды. Нижние концы этих каналов вдавливаются по типу пищевых вакуолей в эндоплазму. Пиноцитоз индуцируется только некоторыми активными веществами в среде, окружающей клетку. Этим методом поглощаются высокомолекулярные соединения из внешней среды.

    Сапрозойное питание: Включает поглощение пищи путем осмоса через общую поверхность тела. Поэтому этот метод называется осмотрофией. Пищей в основном является мертвое органическое вещество, переработанное разлагающимися бактериями. Такое питание встречается у Mastigamoeba , а также у некоторых бесцветных жгутиконосцев.

    Сукторианы питаются другими инфузориями с помощью своих щупалец, имеющих воронкообразные концы. Каждое щупальце состоит из округлой жесткой центральной трубки.Как только жертва прикрепляется, кончики щупалец парализуют жертву некоторым количеством гипнотоксина и постепенно всасывают жидкости тела центральными трубками.

    Миксотрофное питание: Это комбинация более чем одного режима питания. Многие простейшие, использующие фотосинтез в качестве средства, также получают часть своего рациона в растворенной форме путем осмотрофии или в твердой форме путем фагоцитоза. Лучшими примерами такого питания являются жгутиконосцы, такие как Euglena и Peranema .

    Питание паразитических простейших: Механизмы, используемые паразитическими простейшими, почти аналогичны механизмам их непаразитических простейших. Паразиты, населяющие кишечник и кровь, имеют четко выраженный рот, через который в процессе фаготрофии попадают пищевые частицы. Осмотротрофные формы простейших бывают целозойскими или гистозойскими. Целозойские формы поглощают пищу своей клеточной поверхностью. Гистозойные формы питаются веществами путем осмотрофии.Паразитические сапрозойные формы могут также непосредственно использовать сыворотку крови хозяина.


     

    ПАРАЗИТИЗМ ПРОСТЕЙШИХ

    Паразитизм — это греческое слово, которое означает есть рядом друг с другом (пара = рядом, ситос = пища). Паразиты – это виды, живущие за счет некоторых других видов. Другие животные, на которых живут паразиты, называются хозяевами. Паразиты биологически и экономически тесно связаны с хозяевами на протяжении всей своей жизни.Следовательно, паразитизм можно определить как связь между паразитами и их хозяевами. Это ассоциация между двумя организмами, при которой паразит временно или постоянно живет и питается в теле хозяина или на нем. Почти все группы простейших имеют паразитические виды, а группа споровиков исключительно паразитирует.

     

    Виды паразитов

    Эктопаразиты: Это паразиты, населяющие внешнюю поверхность своих хозяев.

    Например: Hydramoeba hydrozena , питающаяся эктодермальными клетками гидры,

           Icthyopthirius multifilis, погружающийся в эпидермис пресноводных рыб

    Эндопаразиты: Это паразиты, населяющие внутренние поверхности своих хозяев. Они могут быть далее подразделены на следующие типы:

    • Паразиты, обитающие в просвете пищеварительного тракта хозяина.

    Например: Entamoeba histolytica, Giardia lamblia, Isospora hominis, Balantidium coli

    • Паразиты, обитающие в ротовой полости хозяев.

    Например: Trichomonas tenax, Entamoeba gingivalis

    • Паразиты, обитающие в половых путях хозяев.

    Например: Trichomonas vaginalis

    • Паразиты, живущие в тканях хозяина. Они могут попасть в ткани хозяина через кожу или даже из пищеварительного тракта.

    Например: Trypanosoma, Plasmodium, Leishmania, Babesia

    Гиперпаразиты : Это простейшие, паразитирующие на других паразитических простейших.Другими словами, это паразиты на паразитах.

    Например: Zelleriella, Nosema notabilis, Sphaerospora polymorpha

    Патогенные паразиты: Обычно паразитические простейшие не всегда патогенны, но иногда эти паразиты являются патогенными и могут вызывать серьезные заболевания у людей и других животных. Эти паразиты, вызывающие заболевание, называются патогенными паразитами.

    Например: Leishmania donovani, Plasmodium vivax, Trypanosoma gambiense

     

    Специфика хоста

    Простейшие паразиты обычно зависят от хозяина, и в этом отношении наблюдаются две тенденции.

    • Во-первых, некоторые из паразитов, такие как трипаносомы, энтамёбы и эймерии, успешно паразитируют на широком круге хозяев.
    • Во-вторых, некоторые паразиты, такие как Plasmodium, ограничивают себя только несколькими конкретными хозяевами.

     

    Трансмиссия

    Простейшие паразиты различными путями передаются своим хозяевам. Ниже приведены несколько примеров различных способов, которыми простейшие паразиты достигают своих хозяев,

    .
    Простейший паразит
    Тип коробки передач
    Метод передачи
    Entamoeba gingivalis Прямая передача Механическим контактом, например, поцелуями.
    Entamoeba histolytica Перенос загрязнений Через цисты в зараженной пище или воде
    Trypanosoma sps. Прививочный перенос По беспозвоночным переносчикам
    Plasmodium sps. Прививочный перенос По беспозвоночным переносчикам
    Babesia sps. Врожденный перенос Путем инвазии яичников или яйцеклеток
    Эймерия тенелла Перенос загрязнений Через цисты в зараженной пище или воде

     

    Жизненный цикл простейших паразитов

    Многие простейшие паразиты имеют одного хозяина на протяжении всего жизненного цикла, и лишь часть жизни проводят вне хозяина.Эти паразиты, имеющие только одного хозяина в своем жизненном цикле, называются моногенетическими паразитами. Например, Eimeria и Monocystis

    .

    Многие другие простейшие паразиты в течение своего жизненного цикла имеют двух или более хозяев. Эти два хозяина, включенные в жизненный цикл простейшего паразита, принадлежат к разным группам животных. Два хозяина обозначаются как первичные или окончательные хозяева, в которых развились предки паразита. Другой хост называется вторичным хостом, вектором или промежуточным хостом.Этот вектор действует как передающий агент для паразита. Эти паразиты с более чем двумя хозяевами в своем жизненном цикле называются дигенетическими паразитами. Например, трипаносома и плазмодий

    .

    Иногда хозяин-резервуар может неопределенно долго содержать патоген без каких-либо побочных эффектов. Один и тот же резервуарный хозяин может быть повторно инфицирован несколько раз.

    Если паразит проходит часть своего жизненного цикла в переносчике, то его передача называется циклической. Если паразит не проходит часть своего жизненного цикла в переносчике, то его передача называется механической передачей.

     

    Воздействие простейших паразитов на их хозяев

    Паразиты могут вызывать некоторые изменения в своих хозяевах. Некоторые паразиты могут также оказаться вредными для хозяина, в то время как другие могут не оказывать на него никакого действия. Ниже приведены несколько примеров,

    • Entamoeba histolytica разрушает толстую кишку хозяина, что, в свою очередь, вызывает изъязвление.
    • Eimeria stiedae вызывает гиперплазию клеток печени кроликов.
    • Polymnia nebulosa , паразит дождевого червя, вызывает гипертрофию материнских клеток сперматозоидов.
    • Plasmodium gallinaceum , малярийный паразит птиц, закупоривает тонкие кровеносные капилляры


    1. Различают эктопаразитов и эндопаразитов. Также приведите примеры для каждого.
    2. Что такое патогенные паразиты? Приведите несколько примеров из Phylum Protozoa.
    3. Объясните общий жизненный цикл простейших паразитов.
    4. Каково воздействие простейших паразитов на их хозяев.
    5. Назовите типы питания простейших.
    6. Опишите процесс пиноцитарного питания.
    7. Объясните механизм питания сукторианцев.
    8. Что такое миксотрофное питание?

    — Поделись с друзьями! —

    Роль почвенных бактерий | Ohioline

    Микробы в почве напрямую связаны с рециркуляцией питательных веществ, особенно углерода, азота, фосфора и серы.Бактерии представляют собой основной класс микроорганизмов, поддерживающих почву в здоровом и продуктивном состоянии.

    Характеристики бактерий
    Рис. 1. Инфузория (простейшие) крупным планом на фоне различных бактерий. Фотография Тима Уилсона. Используется с разрешения и все права защищены.

    Ingham (2009, стр. 18) утверждает, что «Бактерии представляют собой крошечные одноклеточные организмы, обычно шириной 4/100 000 дюйма (1 мкм).Чайная ложка продуктивной почвы обычно содержит от 100 миллионов до 1 миллиарда бактерий. Это столько же, сколько две коровы на акр. Тонна микроскопических бактерий может быть активной на каждом акре». Хотя бактерии могут быть маленькими, они составляют как самое большое количество, так и биомассу (вес) любого почвенного микроорганизма. На рис. 1 показаны простейшие инфузории, питающиеся бактериями.

    Бактерии по размеру аналогичны частицам глинистой почвы (<0,2 мкм) и частицам ила (2–50 мкм). Они растут и живут в тонких пленках воды вокруг частиц почвы и вблизи корней в области, называемой ризосферой.Небольшой размер бактерий позволяет им быстрее расти и адаптироваться к меняющимся условиям окружающей среды, чем более крупные и сложные микроорганизмы, такие как грибы.

    Большинство почв — просто кладбище мертвых клеток бактерий. Бактерии настолько просты по строению, что их часто называют мешком с ферментами и/или растворимым мешком с удобрением (Dick, R., 2009). Поскольку бактерии живут в условиях голодания или нехватки воды в почве, они быстро размножаются при наличии оптимальных условий воды, пищи и окружающей среды. Популяция бактерий может легко удвоиться за 15-30 минут. Процветающие микробные популяции со временем повышают продуктивность почвы и урожайность.

    Классификация бактерий

    Большинство бактерий относятся к одной из следующих четырех категорий.

    Форма бактерий

    Когда ученые впервые начали классифицировать бактерии, они начали с изучения их основной формы. Бактерии обычно имеют три основные формы: палочки, сферы и спирали.Актиномицеты по-прежнему классифицируются как бактерии, но они похожи на грибы, за исключением того, что они меньше по размеру. Классифицировать бактерии по форме сложно, потому что многие бактерии имеют разную форму и разное расположение.

    Аэробные и анаэробные бактерии

    Большинство микробов, как правило, неактивны и могут иметь только короткие всплески активности в почве. Уровень кислорода в почве часто определяет активность почвенных бактерий (Dick, W. , 2009). Большинство почвенных бактерий предпочитают хорошо насыщенные кислородом почвы и называются аэробными бактериями, которые используют кислород для разложения большинства соединений углерода.Примеры аэробных бактерий включают род Aerobacter , который широко распространен в почве, и бактерии актиномицетов рода Streptomyces , которые придают почве приятный «земляной» запах (Lowenfels & Lewis, 2006).

    Анаэробные бактерии предпочитают, а некоторым требуется среда без кислорода. Анаэробные бактерии обычно встречаются в уплотненной почве, глубоко внутри почвенных частиц (микросайтов) и влажных почвах, где кислород ограничен. Многие патогенные бактерии предпочитают анаэробные почвенные условия и, как известно, превосходят или уничтожают аэробные бактерии в почве.Многие анаэробные бактерии обнаруживаются в кишечнике животных и связаны с навозом и неприятными запахами (Lowenfels & Lewis, 2006).

    Грамотрицательные и грамположительные бактерии

    Когда в лаборатории используется краситель, бактерии можно классифицировать как «граммотрицательные» или «граммположительные». Окрашивающий агент прикрепляется к клеточным стенкам бактерий. Грамотрицательные бактерии, как правило, являются самыми мелкими бактериями и чувствительны к засухе и нехватке воды.Грамположительные бактерии намного больше по размеру, имеют более толстые клеточные стенки, отрицательные заряды на внешней поверхности клеточных стенок и склонны противостоять водному стрессу (Dick, R., 2009). Bacteroides — это анаэробные грамотрицательные бактерии, обитающие в кишечнике человека и животных. Listeria представляет собой грамположительные аэробные палочковидные бактерии, обнаруженные в зараженных пищевых продуктах.

    Другие классификации бактерий

    Другой способ классификации бактерий — по их росту и размножению.Автотрофные бактерии (также называемые автотрофами) перерабатывают углекислый газ, чтобы получить свой углерод. Некоторые автотрофные бактерии непосредственно используют солнечный свет и углекислый газ для производства сахаров, в то время как другие зависят от других химических реакций для получения энергии. Водоросли и цианобактерии являются некоторыми примерами автотрофных бактерий. Гетеротрофные бактерии получают свои углеводы и/или сахара из окружающей среды или живого организма или клетки, в которой они обитают. Примеры включают бактерии Arthrobacter , участвующие в нитрификации азота (Sylvia et al., 2005).

    Благодаря новым достижениям в секвенировании ДНК большинство ученых классифицируют бактерии на основе типа среды, в которой они обитают. Бактерии могут жить в экстремальных условиях, например, в горячих источниках для серных бактерий, или в экстремально холодных условиях, например, в ледяной воде в Арктике. Бактерии также можно классифицировать по тому, как они живут в сильно кислой среде по сравнению с щелочной, аэробной по сравнению с анаэробной или автотрофной по сравнению с гетеротрофной средой (Dick, R., 2009).

    Функциональные группы бактерий

    Бактерии выполняют множество важных экосистемных услуг в почве, включая улучшение структуры почвы и агрегацию почвы, повторное использование питательных веществ в почве и повторное использование воды. Почвенные бактерии образуют микроагрегаты в почве, связывая частицы почвы вместе со своими выделениями. Эти микроагрегаты подобны строительным блокам для улучшения структуры почвы. Улучшенная структура почвы увеличивает инфильтрацию воды и увеличивает водоудерживающую способность почвы (Ingham, 2009).

    Бактерии выполняют важные функции в почве, разлагая органические остатки ферментами, выделяемыми в почву. Ingham (2009) описывает четыре основные функциональные группы почвенных бактерий: редуценты, мутуалисты, патогены и литотрофы.Каждая функциональная группа бактерий играет роль в переработке питательных веществ в почве.

    Разлагатели потребляют легко усваиваемые соединения углерода и простые сахара и связывают растворимые питательные вещества, такие как азот, в своих клеточных мембранах. Бактерии преобладают в пахотных почвах, но их эффективность в переработке углерода составляет всего 20-30 процентов (С). Бактерии имеют более высокое содержание азота (N) (10-30 процентов азота, соотношение C:N от 3 до 10), чем большинство микробов (Islam, 2008).

    Среди мутуалистических бактерий есть четыре типа бактерий, которые превращают атмосферный азот (N 2 ) в азот для растений.Существует три типа почвенных бактерий, которые фиксируют азот без растения-хозяина и свободно живут в почве, включая Azotobacter, Azospirillum и Clostridium .

    Рисунок 2: Азотфиксирующие бактерии Rhizobium образуют клубеньки на корне сои. Фото Рэндалла Ридера. Используется с разрешения и все права защищены.

    Бактерии Rhizobium (грамотрицательные палочковидные бактерии) связываются с растением-хозяином: бобовыми (люцерна, соевые бобы) или клевером (красным, сладким, белым, малиновым) с образованием азотных клубеньков для фиксации азота для растения рост.Растение поставляет углерод Rhizobium в виде простых сахаров. Бактерии Rhizobium берут азот из атмосферы и преобразуют его в форму, которую могут использовать растения. Для использования в растениях атмосферный азот (N 2 ) или реактивный азот соединяется с кислородом с образованием нитрата (NO 3 ) или нитрита (NO 2 ) или соединяется с водородом с образованием аммиака ( NH 3 + ) или аммония (NH 4 + ), которые используются растительными клетками для производства аминокислот и белков (Lowenfels & Lewis, 2006).На рис. 2 показаны азотфиксирующие бактерии.

    Многие почвенные бактерии перерабатывают азот в органических субстратах, но только азотфиксирующие бактерии могут перерабатывать азот в атмосфере в форму (связанный азот), которую могут использовать растения. Фиксация азота происходит потому, что эти специфические бактерии продуцируют фермент нитрогеназу. Азотфиксирующие бактерии, как правило, широко распространены в большинстве типов почв (как свободно живущие почвенные виды, так и виды бактерий, зависящие от растения-хозяина). Свободноживущие виды обычно составляют лишь очень небольшой процент от общей микробной популяции и часто представляют собой штаммы бактерий с низкой способностью связывать азот (Dick, W. , 2009).

    Нитрификация — это процесс, при котором нитрифицирующие бактерии превращают аммиак (NH 4 + ) в нитрит (NO 2 ), а затем в нитрат (NO 3 ). Бактерии и грибы обычно потребляются простейшими и нематодами, а микробные отходы, которые они выделяют, представляют собой аммиак (NH 4 + ), который представляет собой доступный для растений азот. Нитритобактерии ( Nitrosomonas spp.) превращают аммиак в нитриты (NO 2 ) и нитратные бактерии ( Nitrobacter spp.) может затем преобразовать нитриты (№ 2 ) в нитраты (№ 3 ). Нитрифицирующие бактерии предпочитают щелочные почвенные условия или pH выше 7 (Lowenfels & Lewis, 2006). И нитрат, и аммиак являются доступными для растений формами азота; однако большинство растений предпочитают аммиак, потому что нитрат должен быть преобразован в аммиак в растительной клетке для образования аминокислот.

    Денитрифицирующие бактерии позволяют превращать нитраты (NO 3 ) в закись азота (N 2 O) или диазот (N 2 ) (атмосферный азот).Чтобы произошла денитрификация, должен возникнуть недостаток кислорода или анаэробные условия, чтобы бактерии могли отщеплять кислород. Эти условия обычны на запруженных или насыщенных полях, уплотненных полях или глубоко внутри микроагрегатов почвы, где кислород ограничен. Денитрифицирующие бактерии снижают азотное плодородие почв, позволяя азоту улетучиваться обратно в атмосферу. На насыщенной глинистой почве от 40 до 60 процентов почвенного азота может быть потеряно в результате денитрификации в атмосферу (Dick, W., 2009).

    Болезни растений вызывают патогенные бактерии, хорошим примером которых являются бактериальные ожоги. Здоровые и разнообразные популяции почвенных бактерий вырабатывают антибиотики, которые защищают растения от болезнетворных организмов и патогенов растений. Разнообразные популяции бактерий конкурируют за одни и те же питательные вещества почвы и воду и, как правило, действуют как система сдержек и противовесов, сокращая популяции болезнетворных организмов. При высоком микробном разнообразии в почвах больше непатогенных бактерий, конкурирующих с патогенными бактериями за питательные вещества и среду обитания (Lowenfels & Lewis, 2006). Streptomycetes (актиномицеты) продуцируют более 50 различных антибиотиков для защиты растений от патогенных бактерий (Sylvia et al., 2005).

    Литотрофы (хемоавтотрофы) получают энергию из соединений, отличных от углерода (таких как азот или сера), и включают виды, важные для рециркуляции азота и серы. В условиях хорошей аэрации сероокисляющие бактерии делают серу более доступной для растений, в то время как в условиях насыщенной (анаэробной, с низким содержанием кислорода) почвы сероредуцирующие бактерии делают серу менее доступной для растений.

    Актиномицеты имеют крупные нити или гифы и действуют аналогично грибкам при обработке трудноразлагаемых органических остатков почвы (хитин, лигнин и т.д.). Когда фермеры вспахивают или обрабатывают почву, актиномицеты, умирая, выделяют «геосмин», который придает свежевспаханной почве характерный запах. Актиномицеты разлагают многие вещества, но более активны при высоких уровнях pH почвы (Ingham, 2009). Актиномицеты играют важную роль в формировании стабильного гумуса, который улучшает структуру почвы, улучшает хранение питательных веществ и увеличивает удержание воды.

    Преимущества почвы от бактерий

    Бактерии растут во многих различных микросредах и определенных нишах в почве. Популяции бактерий быстро увеличиваются, и бактерии становятся более конкурентоспособными, когда легко усваиваемые простые сахара легко доступны в ризосфере. В этом регионе в изобилии встречаются корневые экссудаты, отмершие растительные остатки, простые сахара и сложные полисахариды. От 10 до 30 процентов почвенных микроорганизмов в ризосфере составляют актиномицеты, в зависимости от условий окружающей среды (Sylvia et al., 2005).

    Многие бактерии производят слой полисахаридов или гликопротеинов, который покрывает поверхность частиц почвы. Эти вещества играют важную роль в цементировании частиц песка, ила и глины в устойчивые микроагрегаты, улучшающие структуру почвы. Бактерии живут по краям минеральных частиц почвы, особенно глины и связанных с ней органических остатков. Бактерии играют важную роль в производстве полисахаридов, которые скрепляют частицы песка, ила и глины, образуя микроагрегаты и улучшая структуру почвы (Hoorman, 2011).Бактерии не перемещаются очень далеко в почве, поэтому большинство перемещений связано с водой, отрастанием корней или с другими представителями почвенной фауны, такими как дождевые черви, муравьи, пауки и т. д. (Lavelle & Spain, 2005).

    В целом, большинство почвенных бактерий лучше себя чувствуют в почвах с нейтральным pH, которые хорошо насыщены кислородом. Бактерии обеспечивают большое количество азота растениям, а азота часто не хватает в почве. Многие бактерии выделяют ферменты в почве, чтобы сделать фосфор более растворимым и доступным для растений.В целом, бактерии, как правило, доминируют над грибами в распаханных или нарушенных почвах, потому что грибы предпочитают более кислую среду без нарушения почвы. Бактерии также преобладают на затопленных полях, потому что большинство грибов не выживают без кислорода. Бактерии могут выживать в засушливых или затопленных условиях благодаря своему небольшому размеру, большому количеству и способности жить в небольших микроучастках в почве, где условия окружающей среды могут быть благоприятными. Как только условия окружающей среды вокруг этих микроучастков становятся более благоприятными, выжившие быстро увеличивают свою популяцию (Dick, W., 2009). Простейшие, как правило, являются крупнейшими хищниками бактерий в пахотных почвах (Ислам, 2008).

    Чтобы бактерии выжили в почве, они должны адаптироваться ко многим микросредам. Концентрация кислорода в почве сильно варьируется от одного микросайта к другому. Большие поры, заполненные воздухом, обеспечивают высокий уровень кислорода, что способствует аэробным условиям, в то время как более мелкие микропоры на расстоянии нескольких миллиметров могут быть анаэробными или лишенными кислорода. Это разнообразие почвенной микросреды позволяет бактериям процветать при различной влажности почвы и уровне кислорода, потому что даже после затопления (насыщенность почвы, нехватка кислорода) или обработки почвы (насыщение кислородом) существуют небольшие микросреды, в которых могут жить разные виды бактерий и микроорганизмов. для повторного заселения почвы, когда условия окружающей среды улучшаются.

    Естественная сукцессия происходит в ряде растительных сред, в том числе в почве. Бактерии улучшают почву, чтобы новые растения могли прижиться. Без бактерий новые популяции растений и сообщества борются за выживание или даже за существование. Бактерии изменяют почвенную среду, чтобы определенные виды растений могли существовать и размножаться. Там, где формируется новая почва, некоторые фотосинтезирующие бактерии начинают колонизировать почву, перерабатывая азот, углерод, фосфор и другие питательные вещества почвы для производства первого органического вещества.Почва, в которой преобладают бактерии, обычно распахана или разрушена, имеет более высокий pH почвы и азот, доступный в виде нитратов, что является идеальной средой для растений с низкой сукцессией, называемых сорняками (Ingham, 2009).

    По мере того, как почва меньше нарушается, а разнообразие растений увеличивается, пищевая цепь почвы становится более сбалансированной и разнообразной, что делает почвенные питательные вещества более доступными в среде, более подходящей для высших растений. Разнообразные микробные популяции с грибками, простейшими и нематодами поддерживают рециркуляцию питательных веществ и контролируют болезнетворные организмы.

    Сводка

    Бактерии — это самые маленькие и самые выносливые микробы в почве, которые могут выжить в суровых или изменяющихся почвенных условиях. Бактерии эффективны только на 20–30% при переработке углерода, имеют высокое содержание азота (от 10 до 30% азота, соотношение C:N 3–10), более низкое содержание углерода и короткую продолжительность жизни. Существуют в основном четыре функциональные группы почвенных бактерий, включая редуцентов, муталистов, патогенов и литотрофов. Бактерии-редуценты потребляют простые сахара и простые соединения углерода, в то время как мутуалистические бактерии образуют партнерские отношения с растениями, включая азотфиксирующие бактерии ( Rhizobia ).Бактерии также могут стать патогенами для растений, а литотрофные бактерии преобразуют азот, серу или другие питательные вещества в энергию и играют важную роль в круговороте азота и разложении загрязнений. Актиномицеты классифицируются как бактерии, но очень похожи на грибы и разлагают неподатливые (трудно разлагающиеся) органические соединения. Бактерии обладают способностью адаптироваться к различным почвенным микросредам (влажным или сухим, насыщенным кислородом или низким содержанием кислорода). Они также обладают способностью изменять почвенную среду, принося пользу определенным растительным сообществам по мере изменения почвенных условий.

    Каталожные номера
    • Дик, Р. (2009). Лекция о почвенных бактериях в почвенной микробиологии, личная коллекция Р. Дика, Школа окружающей среды и природных ресурсов Университета штата Огайо, Колумбус, Огайо.
    • Дик, В. (2009). Лекция о биохимическом процессе в почвенной микробиологии, личная коллекция У. Дика, Школа окружающей среды и природных ресурсов Университета штата Огайо.
    • Хорман, Дж.Дж., Са, Дж.К.М., и Ридер, Р.К. 2011. Биология уплотнения почвы (пересмотренная и обновленная), Journal of No-till Agriculture , Volume 9, No. 2, стр. 583-587.
    • Ингэм, Э. Р. (2009). Учебник по почвенной биологии , Глава 4: Почвенный грибок. Анкени И.А.: Общество охраны почв и водных ресурсов. стр. 22-23. www.soils.usda.gov/sqi/concepts/soil_biology
    • Ислам, К.Р. (2008). Лекция по физике почв, личная коллекция К. Ислама, Школа окружающей среды и природных ресурсов Университета штата Огайо, Колумбус, Огайо.
    • Лавель, П. и Спейн, А.В. (2005). Экология почвы , Глава 3: Почвенные организмы, Спрингер, Нью-Дели, Индия.
    • Ловенфельс, Дж. и Льюис, В. (2006). Объединение с микробами: Руководство садовода по почвенной пищевой сети , Глава 3: Бактерии, Timber Press, Портленд, Орегон.
    • Ридер, Р.К. (2012). Фотография бактерий и клубеньков Rhizobium, поражающих корни сои, личная коллекция Р. Ридера, отдел пищевой, сельскохозяйственной и биологической инженерии, Государственный университет Огайо, Колумбус, Огайо.
    • Сильвия, Д.М., Хартел, П.Г. Фурманн, Дж.Дж.

Добавить комментарий

Ваш адрес email не будет опубликован.