Содержание

Класс Жгутиковые

Характерной чертой данного класса является наличие жгутика. Жгутики – органоиды движения простейших. Движение происходит благодаря вращению жгутика, который расположен на переднем конце тела. Разные виды Жгутиковых могут иметь от одного до множества жгутиков.

Жгутиковых можно встретить в морях, пресных водоёмах, почве и в живых организмах. Внешне жгутиковые выглядят очень разнообразно: могут быть овальной, шаровидной, веретеновидной форм. У большинства представителей данного класса имеется постоянная форма тела.

Жгутиковые делятся на три группы по типу питания. Гетеротрофные простейшие используют готовые органические вещества, т.к. их клетки не имеют хлорофилла, и они не могут осуществлять фотосинтез. Это, например, трипаносома. Жгутиковые, содержащие хлорофилл, способны к фотосинтезу и имеют

автотрофный тип питания. Например, вольвокс. Для некоторых видов, например, эвглена зелёная, характерен миксотрофный, или смешанный, тип питания, поскольку на свету они способны к фотосинтезу, а в темноте питаются готовыми органическими веществами.

Жгутиковые бывают одиночными (свободноживущими и паразитическими) и колониальными. Рассмотрим основных представителей класса Жгутиковые.

Вольвокс. Это шаровидный колониальный организм, который можно встретить в прудах и озерах. Он имеет размеры от 1 до 2 мм. Вольвокс состоит из нескольких сотен клеток, погружённых в студенистое вещество. Каждая клетка имеет два жгутика, с помощью которых вольвокс перекатывается в толще воды. Отсюда и происходит название «вольвокс», означающее «катящийся».  Колония развивается из одной жгутиковой клетки. При дальнейшем делении клетки не расходятся, а продолжают существовать вместе.

Когда условия жизни благоприятны, некоторые клетки вольвокса погружаются внутрь и начинают быстро делиться. Так образуются дочерние колонии вольвокса, которые выходят из старого вольвокса наружу и начинают вести самостоятельный образ жизни.

Кроме вольвокса, к колониальным организмам относятся пандорина, эвдорина, гониум.

Эвглена зеленая – свободноживущий одноклеточный организм, имеет размеры около 0,06 мм. Обитает в пресных водоёмах со стоячей загрязненной водой. Рассмотрим ее строение. Имеет постоянную форму тела, т.к. ее тело покрыто плотной оболочкой. На переднем конце тела располагается жгутик. Вся клетка заполнена цитоплазмой, в которой располагаются ядро, около 20 хлоропластов, сократительная вакуоль, которая, как и у всех простейших, осуществляет выделение излишней воды. Интересной особенностью является наличие

стигмы – светочувствительного глазка, содержащего красный пигмент. Светочувствительный глазок помогает находить освещённые места в водоёме, где более благоприятны условия для фотосинтеза.

Тип питания – миксотрофный. По этому признаку эвглена занимает промежуточное положение между растениями и животными. На свету она является автотрофом. В хроропластах, содержащих хлорофилл, идет фотосинтез. Когда на длительное время эвглена попадает в темноту, она теряет хлорофилл и становится бесцветной. Тогда она начинает всасывать готовые органические вещества всей поверхностью тела, т.е. становится гетеротрофом.

Дыхание и выделение происходит всей поверхностью тела.

Размножение бесполое – продольное деление клетки надвое. Сначала делится ядро, после чего разделяется вся клетка. Жгутик при этом может отделяться, и тогда дочерние особи формируют его заново, или отходит одной из клеток, в этом случае отстраивать его приходится только одной молодой клетке.

В неблагоприятных условиях эвглена, как и амёба, образует цисту.

Другие жгутиковые не имеют хлоропластов. Среди них встречаются свободноживущие и паразитические особи, которые вызывают тяжёлые заболевания, в том числе и у человека.

Африканские трипаносомы являются возбудителями тяжелейшей сонной болезни. Переносчиками паразита являются кровососущие мухи цеце, которые заражают животных и человека. Со слюной мухи при укусе паразит попадает в кровь человека, после чего поражает мозг. Симптомы болезни вначале проявляются в виде слабой лихорадки, но затем появляется мышечная слабость, утомляемость, сонливость. Развивается глубокое истощение организма. Без лечения болезнь приводит к гибели.

Среди паразитов человека важная роль принадлежит лейшманиям, получившим название в честь английского врача Уильяма Лейшмана, который одним из первых описал этих паразитов. Они паразитируют в крови человека и животных.

Также известны трихомонады, которые имеют несколько жгутиков, и лямблии. Лямблии – это простейшие, получившие свое название в честь профессора Душана Фёдоровича Лямбля, открывшего их в 1859 году. Организм имеет 2 ядра и 8 жгутиков. Заселяет тонкую кишку человека.

Характерные особенности класса Жгутиковые:

·         Большинство имеет 1 ядро;

·         Постоянная форма тела;

·         Органоиды движения – жгутики;

·         Тип питания: гетеротрофный, автотрофный или миксотрофный;

·         Размножение: бесполое, у некоторых встречается половой процесс.

Жгутиконосцы — животное, описание, характеристика, строение, питание, дыхание, размножение, где обитает, виды, фото, вики — WikiWhat

Жгутиконосцы — это одноклеточные животные, которые передвигаются при помощи жгутиков.

Кроме животных жгутиконосцев (рис. 1) есть растительные жгутиконосцы, которые относятся к одноклеточным водорослям, как хламидомо­нада. Они обладают автотрофным способом питания, имеют хлорофилл и способны к фотосинтезу.

Кроме того, среди жгутиконосцев есть одноклеточные организмы, для кото­рых характерны как признаки растений, так и животных. Это эвглены. Так, эвглена зеленая на свету питается, как зеленое растение. Если поместить ее на длительное время в темноту, хлорофилл у нее исчезает, она становится бес­цветной и начинает питаться готовыми органическими веществами, как животное.

Способность эвглен переходить из зеленой формы в бесцвет­ную показывает, как могли образоваться животные жгутико­носцы из растительных жгутиконосцев. Здесь становится понятно, почему граница, разделяющая виды на зоологические и ботанические объекты, рассекает надвое некоторые безусловно родственные группы организ­мов.

Как у бодо, так и у хламидомонады, ядро отделено от цитоплазмы ядерной оболочкой. Ядро содержит не толь­ко программы, как построить тело одноклеточного орга­низма, но и как действовать в разных ситуациях. Материал с сайта http://wikiwhat.ru

Хламидомонада действует как автотрофный организм и синтезирует все необходимые ей вещества из углекислого газа, воды и минеральных солей. У бодо нет хлоропластов, он гете­ротрофный организм.

Таким образом, они относятся к двум разным царствам: хламидомонада — к зеленым растениям, бодо — к живот­ным.

Картинки (фото, рисунки)

  • Рис. 1. Различные животные жгутиконосцы

Cellular Respiration and Production of Energy | Biology

8.1: Что такое клеточное дыхание?

Организмы получают энергию из пищи, но клетки не могут напрямую использовать эту энергию. Клетки преобразовывают энергию, запасенную в питательных веществах, в более удобную форму: аденозинтрифосфат (АТФ).

АТФ хранит энергию в химических связях, которые при необходимости могут быстро высвобождаться. Клетки производят энергию в виде АТФ в процессе клеточного дыхания. Хотя большая часть энергии клеточного дыхания выделяется в виде тепла, некоторая ее часть используется для производства АТФ.

Во время клеточного дыхания несколько окислительно-восстановительных (окислительно-восстановительных) реакций переносят электроны от органических молекул к другим молекулам. Здесь окисление относится к потере электронов и восстановлению до усиления электронов. Электронные переносчики NAD + и FAD & mdash; и их восстановленные формы, NADH & nbsp; и FADH 2 соответственно & mdash; необходимы для нескольких этапов клеточного дыхания.

Некоторые прокариоты используют анаэробное дыхание, для которого не требуется кислород. Большинство организмов используют аэробное (кислородное) дыхание, которое производит намного больше АТФ. При аэробном дыхании образуется АТФ, расщепляя глюкозу и кислород на углекислый газ и воду.

Как аэробное, так и анаэробное дыхание начинается с гликолиза, для которого не требуется кислород. Гликолиз расщепляет глюкозу на пируват с образованием АТФ. В отсутствие кислорода пируват ферментирует, производя НАД

+ для продолжения гликолиза. Важно отметить, что некоторые виды дрожжей используют спиртовое брожение. Мышечные клетки человека могут использовать молочнокислое брожение при недостатке кислорода. Анаэробное дыхание заканчивается брожением.

Однако аэробное дыхание продолжается с окислением пирувата. Окисление пирувата приводит к образованию ацетил-КоА, который входит в цикл лимонной кислоты. Цикл лимонной кислоты состоит из нескольких окислительно-восстановительных реакций, которые высвобождают энергию связи ацетил-КоА, производя АТФ и восстановленные переносчики электронов НАДН и ФАДН 2 .

На заключительном этапе клеточного дыхания, окислительном фосфорилировании, вырабатывается большая часть АТФ. НАДН и ФАДН 2 передают свои электроны через цепь переноса электронов.

Цепь переноса электронов высвобождает энергию, которая используется для вытеснения протонов, создавая протонный градиент, который обеспечивает синтез АТФ.


Литература для дополнительного чтения

Lane, N. «Why are cells powered by proton gradients.» Nature Education 3(9):18 (2010). [Source]

Martin, W. & Mentel, M. The Origin of Mitochondria. Nature Education 3(9):58 (2010). [Source]

СИЗ для защиты дыхания, зрения и слуха

 

В условиях производства зачастую работать приходится в атмосфере пораженной химическими агентами или другими загрязнителями. Для того чтобы сохранить здоровье и обеспечить технику безопасности на современных промышленных предприятиях обязательно применение средств защиты. Компания 3М на протяжении 25 лет занимается производством высокотехнологичных средств индивидуальной защиты. В портфолио марки защитные очки, маски и полумаски, респираторы, головные щитки, противошумные наушники и беруши – все для защиты органов дыхания, зрения и слуха. В этой статье расскажем о видах защитных средств, поможем с выбором и научим правильно ими пользоваться.

 
СИЗ для защиты дыхания

 

 

Основная цель этого оборудования – предотвратить попадание пыли, вредных химических веществ, газов, аэрозолей в легкие. Маски и полумаски должны плотно прилегать, быть удобными в носке, обладать низким сопротивлением дыханию. Применение СИЗ для защиты органов дыхания позволяют свести к минимуму вероятность получения профессиональных легочных заболеваний.

 

Респираторы

Обеспечьте респираторами сотрудников, которые работают в сверхсложных условиях, где загрязнение воздуха более 200 ПКД. В подмасочное пространство нагнетается очищенный воздух в количестве во много раз большем, чем человеку необходимо для дыхания. Во время ношения не образуется конденсата, распиратор плотно и удобно прилегает к лицу, препятствует попадания загрязненного воздуха. Небольшой вес способствует комфортному ношению и работе в тяжелых условиях на протяжении всей смены.

Полумаски

Фильтрующие полумаски 3М удобны и обладают плотным прилеганием благодаря 3-х панельной конструкции. Она позволяет подстроить полумаску к индивидуальным особенностям лица. Для очистки воздуха используется высокоэффективный фильтрующий материал. Дополнительные элементы конструкции делают СИЗ еще более удобным в носке: рельефная верхняя панель, язычок для надевания, фигурная вырубка обеспечивает совместимость с очками.

 



Если на производстве приходится противостоять не только пыли, и химическим агентам, но и неприятным запахам, выбирайте специализированные фильтрующие маски. Защита обеспечивается за счет слоя активированного угля, улавливающего неприятные запахи.

 
Сварочные работы требуют особых мер безопасности. 3М предлагает фильтрующие полумаски предохраняющие от попадания в дыхательные пути мелкодисперсных сварочных дымов. Не попасть в ваши легкие цинку, хрому, озону, железу и другим тяжелым металлам поможет слой активированного угля в качестве абсорбента.

Полнолицевые маски и противогазы

Идеальное решение для работы в условиях высокой концентрации загрязнения воздуха (запыленность, загазованность), когда поражения могут затронуть все лицо: кожу, слизистые и, в том числе, органы дыхания. Несмотря на то, что маска покрывать все лицо, это не мешает обзору, что является необходимым условием работы на предприятии. Срок службы маски увеличивает возможность замены деталей. Если перетерлись ремни или поцарапана линза, ее можно просто заменить, сэкономив на приобретении нового изделия.

 
Применяются в:

фармации;
машиностроении, металлообработке;
добыче угля, работах в шахте.
 

СИЗ для защиты зрение

 
Средства защиты глаз необходимы рабочим многих профессий. Они предотвращают повреждение слизистых от летящих частиц, дымов и раздражающих твердых веществ, жидкостей и газов при полировке, измельчении, резке, взрывных работах, дроблении, химических процессах, обеспечивают защиту от интенсивного лазерного излучения, при работе вблизи источников высокой температуры и излучений при выполнении сварки.

 
Чтобы быть эффективным, используемое защитное оборудование должно соответствовать конкретному виду опасности. Иногда надежнее использовать средства защиты всей поверхности лица. Опционально надевают защитный капюшон или шлем, либо защитную маску, закрывающую все лицо. Для сохранения здоровья глаз применяют открытые и закрытые очки.

 

Защитные очки

Очки обязательны к ношению работников все время нахождения в производственной зоне. Но многие пренебрегают этим аксессуаром, находя его неудобным:

очки неплотно сидят на лице: сползают или слишком сильно сдавливают;
линзы быстро царапаются и запотевают.

Неудобные очки и пренебрежение техникой безопасности привели к 1700 случаям травмирования работниками органов зрения (о чем свидетельствуют данные ФСС России).

 
Очки 3М имеют регулировку душек, наклон линз, возможность установки уплотнителей, специальных покрытий с внешней и внутренней стороны линзы для защиты от царапин и запотевания. При этом не страдает степень защиты зрения.

Сварочные маски

Сварка – это не только физически, но и технически сложная работа. Профессиональные сварщики подвергаются целому комплексу вредных факторов: УФ, ИК и электромагнитное излучение, сварочный дым, газы и пары, искры и брызги металла, а также монотонный высокочастотный шум.

 

 Ультрафиолетовое излучение способно вызвать ожог роговицы, сопровождающийся слезоточивостью, резью, нарушением зрения и болью в глазах. Сварочный фильтр обладает высокими оптическими характеристиками. Однородное затемнение и минимальное искажение стабильно обеспечивает безопасность труда.

 

Сварочные маски 3М зарекомендовали себя при работе в низких температурах. Удобны в носке, что особенно важно для сварщиков, чья смена обычно составляет 6-8 часов. Маска не мешает в работе и не понижает производительности. За счет системы отвода выдыхаемого воздуха не образуется конденсата. Сварщику не нужно приподнимать маску, чтобы отдышаться.

СИЗ для защиты слуха

 

 

При шуме выше 80 дБ работник должен постоянно использовать СИЗ для защиты слуха. Нейросенсорная тугоухость – профессиональное заболевание рабочих, которые регулярно подвергаются воздействию повышенного уровня шума без специального защитного оборудования.

Беруши

Беруши – эффективный и простой способ защитить слух при высоком уровне шума. Правильно вставьте вкладыш в ушной канал, чтобы звукоизоляция была максимальной. Чистыми руками туго скрутите беруши до состояния жгутика. Приподнимите ухо для выравнивания ушного канала. Многоразовые беруши не требуют таких манипуляций. Их форма эргономична ушному каналу и обеспечивает комфортное прилегание. Их можно мыть и использовать многократном не переживая за гигиену.

Противошумные наушники

Многочасовое ношение обязывает наушники быть удобными и хорошо сочетаться с другими средствами защиты: респиратором, каской и т. д. Чашки наушников 3М прочные и глубокие. Не пропускать шум, но и не создавать повышение температуры и конденсацию влаги. Плотно прилегать, но не создавать чрезмерного давления.


Убедитесь, что характеристика средств индивидуальной защиты органов дыхания, зрения и слуха соответствует вашим требованиям, проверьте состояние и герметичность всех частей. Перед тем, как применять СИЗ на производстве их необходимо проверить. Помните про размер СИЗ! Средства защиты органов дыхания, зрения и слуха соответствующие всем ГОСТам, перестают быть надежными, если они подобраны не по размеру и не по назначению.

Механизм модуляции направления вращения жгутиков у бактерий с помощью фумарата и фумаратредуктазы

. 6 сентября 2019 г .; 431 (19): 3662-3676. doi: 10.1016/j.jmb.2019.08.001. Epub 2019 11 августа.

Принадлежности Расширять

Принадлежности

  • 1 Департамент биомолекулярных наук, Научный институт Вейцмана, 7610001 Реховот, Израиль.
  • 2 Кафедра структурной биологии, Научный институт Вейцмана, 7610001 Реховот, Израиль.
  • 3 Департамент поддержки химических исследований, Научный институт Вейцмана, 7610001 Реховот, Израиль.
  • 4 Отдел молекулярной биологии, Сан-Франциско VA Health Care System, Сан-Франциско, Калифорния , США; Кафедра биохимии и биофизики, Калифорнийский университет, Сан-Франциско, Калифорния , США.
  • 5 Департамент биомолекулярных наук, Научный институт Вейцмана, 7610001 Реховот, Израиль. Электронный адрес: [email protected]
Бесплатная статья ЧВК

Элемент в буфере обмена

Анна Коганицкая и соавт. Дж Мол Биол. .

Бесплатная статья ЧВК Показать детали Показать варианты

Показать варианты

Формат АннотацияPubMedPMID

. 6 сентября 2019 г .; 431 (19): 3662-3676.doi: 10.1016/j.jmb.2019.08.001. Epub 2019 11 августа.

Принадлежности

  • 1 Департамент биомолекулярных наук, Научный институт Вейцмана, 7610001 Реховот, Израиль.
  • 2 Кафедра структурной биологии, Научный институт Вейцмана, 7610001 Реховот, Израиль.
  • 3 Департамент поддержки химических исследований, Научный институт Вейцмана, 7610001 Реховот, Израиль.
  • 4 Отдел молекулярной биологии, Сан-Франциско VA Health Care System, Сан-Франциско, Калифорния , США; Кафедра биохимии и биофизики, Калифорнийский университет, Сан-Франциско, Калифорния , США.
  • 5 Департамент биомолекулярных наук, Научный институт Вейцмана, 7610001 Реховот, Израиль.Электронный адрес: [email protected]

Элемент в буфере обмена

Полнотекстовые ссылки Параметры отображения цитирования

Показать варианты

Формат АннотацияPubMedPMID

Абстрактный

Фумарат, акцептор электронов в анаэробном дыхании Escherichia coli, выполняет дополнительную функцию, помогая жгутиковому двигателю переключаться с вращения против часовой стрелки на вращение по часовой стрелке с последующей модуляцией плавательного поведения бактерий. Фумарат передает свое действие на двигатель через комплекс фумаратредуктазы (FrdABCD), который, как показано, связывается с FliG-одним из белков переключения двигателя. Как связывание респираторного фермента FrdABCD с FliG усиливает вращение по часовой стрелке и как фумарат участвует в этой активности, остается загадкой. Здесь мы показываем, что субъединицы FrdA в присутствии фумарата достаточно для связывания с FliG и для усиления по часовой стрелке. Кроме того, мы демонстрируем с помощью анализов связывания in vitro и микроскопии сверхвысокого разрешения in vivo, что механизм, с помощью которого FrdA, занятый фумаратом, усиливает вращение по часовой стрелке, включает его предпочтительное связывание с состоянием FliG по часовой стрелке (FliG cw ).Электростатика континуума в сочетании с анализом стыковки и выборкой конформации подтвердила экспериментальные выводы и предположила, что взаимодействие FrdA-FliG cw управляется положительным электростатическим потенциалом, генерируемым FrdA и отрицательно заряженными областями FliG. Далее они продемонстрировали, что фумарат изменяет конформацию FrdA на такую, которая может связываться с FliG cw . Эти находки также показывают, что причина неспособности сукцинатдегидрогеназного флавопротеина SdhA (почти идентичный аналог FrdA, который, как показано, одинаково хорошо связывается с FliG) усиливать вращение по часовой стрелке заключается в том, что он не имеет предпочтительного связывания с FliG cw .Мы предполагаем, что этот механизм физиологически важен, поскольку он может модулировать величину ΔG 0 между состояниями двигателя по часовой стрелке и против часовой стрелки, чтобы настроить двигатель на условия роста бактерий.

Ключевые слова: ФлиГ; анаэробный комплекс II; жгутиковый двигатель; белковая электростатика; дыхательные комплексы.

Copyright © 2019 Elsevier Ltd. Все права защищены.

Цифры

Рисунок 1.

Только FrdA может усилить по часовой стрелке…

Рисунок 1.

Только

FrdA может улучшить вращение по часовой стрелке. A , Структура E. coli FrdABCD.…

Фигура 1. Только

FrdA может улучшить вращение по часовой стрелке. A , Структура E. coli FrdABCD. На базе ПДБ 3П4П. B , Вращение по часовой стрелке у мутантов, лишенных отдельных субъединиц FrdABCD. См. Таблицу 2 для штаммов. Долю времени, проведенного при вращении по часовой стрелке, рассчитывали с интервалом в 1 мин непосредственно до и после добавления бензоата (50 мМ, рН 7. 0). Столбцы, отмеченные одной и той же буквой, оказались статистически индифферентными. Столбцы, отмеченные разными буквами, достоверно различались ( P <0,05) по статистическому критерию Крускала-Уоллиса (n = 113–190 клеток). C , Влияние уровня FrdA на вращение по часовой стрелке. Экспрессию показанных субъединиц осуществляли из IPTG-индуцированных плазмид, перечисленных в таблице 2, на фоне B275Δ frdABCD . Там, где указано, фумарат (40 мМ) присутствовал в среде во время роста, но не во время эксперимента.Кривая была нарисована вручную. * P <0,001 (для 10 и 20 мкМ IPTG) или <0,01 (для 200 мкМ IPTG) относительно отсутствия фумарата при той же концентрации IPTG, и ** P <0,05 или <0,001 (для 10 или 20 мкМ ИПТГ соответственно) относительно нулевого ИПТГ в присутствии фумарата по статистическому критерию Крускала-Уоллиса (n = 44–95 клеток). D , Анаэробный рост в присутствии фумарата увеличивает вероятность по часовой стрелке. Используемым штаммом дикого типа был B275. См. Таблицу 1 для других штаммов.Перед привязкой клетки промывали и ресуспендировали в буфере для подвижности, не содержащем фумарата. Низкоростовой контроль соответствует клеткам дикого типа, которые выросли до OD 600 = 0,09, аналогично максимальному OD роста клеток Δ frdABCD в анаэробных условиях. Столбцы, отмеченные одной и той же буквой, оказались статистически индифферентными. Столбцы, отмеченные разными буквами, достоверно различались по критерию Краскела-Уоллиса ( P <0,001, за исключением разницы между аэробным WT+fum и Δ frdA +fum, для которого P <0.05; n = 70–170 клеток). Сокращения: ara, арабиноза; фум, фумарат; LGC, низкорослый контроль; WT, дикий тип.

Рисунок 2.

Привязка FrdA к FliG…

Рисунок 2.

Привязка FrdA к FliG cw контролируется с помощью MST.Концентрация FrdA составила…

Фигура 2.

Привязка FrdA к FliG cw контролируется с помощью MST. Концентрацию FrdA поддерживали постоянной на уровне 15 мкМ, а FliG cw серийно разбавляли 1:1, начиная с 138 мкМ. Естественную флуоресценцию кофактора FAD использовали для измерения сигнала MST. A , следы MST репрезентативного эксперимента. Были взяты средние значения до и после нагревания (синяя и красная области). B , Кривая связывания, полученная путем усреднения значений при каждой концентрации FliG cw в 4 отдельных экспериментах. Кривая соответствует (R 2 =0,955) в соответствии с уравнением закона действующих масс [20], что дает K d = 4±1 мкМ (±SEM, n = 4).

Рисунок 3.

Репрезентативные изображения клеток, содержащих…

Рис. 3.

Репрезентативные изображения клеток, содержащих флуоресцентно меченные FrdA и FliM. А , Б…

Рисунок 3.

Репрезентативные изображения клеток, содержащих флуоресцентно меченные FrdA и FliM. A , B , Комбинированная визуализация PALM/STORM клеток, содержащих моторы дикого типа (штамм DFB190Δ frdABCD , содержащий плазмиды ph4-Dendra2-FrdABCD и pFliM WT -mPlum).Желтые точки представляют отдельные молекулы Dendra2 (FrdA); красные точки представляют отдельные молекулы FliM дикого типа, меченные Alexa 647; FM указывает на расположение жгутиковых моторов. C, D , То же, что в A, B, но для клеток, содержащих моторы с молекулами FliM cw (штамм DFB190Δ frdABCD , содержащий плазмиды ph4-Dendra2-FrdABCD и pFliM CW -mPlum). E , Кольцевая структура молекул FrdA, сформированная вокруг мотора. F , как и в E, но без моторной флуоресценции, чтобы выявить кольцеобразную структуру.

Рисунок 4.

Молекулярная основа для предпочтительного…

Рисунок 4.

Молекулярная основа для предпочтительных взаимодействий, выявленная моделированием МД в сочетании с…

Рисунок 4.

Молекулярная основа предпочтительных взаимодействий, выявленная с помощью моделирования МД в сочетании с анализом докинга. A , «Компактная» конфигурация FliG cw (зеленый) и FliG cw (оранжевый). B , «Расширенная» конформация FliG cw (голубой) и FliG ccw ​​ (лососевый). Обратите внимание на разницу между компактной (А) и расширенной (В) конформациями в отношении расстояния между центром М-домена и центром С-концевого домена. C, D , Компактная конформация FliG cw взаимодействует с FrdA лучше, чем расширенная конформация. На панелях показано распределение электростатического потенциала на сфере радиусом 40 Å вокруг субъединицы FrdA, взаимодействующей с FliG в ее компактной (C) и вытянутой (D) конформациях. Значения электростатического потенциала FrdA на цветных картах даны в кТл/е. Очевидно, что удлиненная конформация менее предпочтительна для связывания с FrdA (D). Более высокая аффинность связывания может быть достигнута в компактной конформации, когда оба мотива ARM C и ARM M FliG входят в «синюю область» вокруг FrdA (C) на начальном этапе процесса связывания, за которым следует конечная стадия. (Э, Ф). В этих исходных «комплексах встречи» (C и D) минимальное расстояние FliG-FrdA поверхность-поверхность (~ 15 Å) обнаружено между Lys121 и Lys281 FrdA и Glu212 из ARM C helix_1 FliG. Энергии электростатического взаимодействия между FliG cw и FrdA оцениваются в диапазоне от -8 до -30 кДж/моль (таблица S1), что предполагает притяжение и эффективное управление на больших расстояниях. E , Предлагаемый способ связывания мономера FrdA с FliG cw . На этом заключительном этапе связывания спираль_1 мотива ARM C вписывается в бороздку на поверхности FrdA, окруженную «кластером лизина».Зеленый, ФлиГ; желтый, С-концевой пучок из шести спиралей; розовый, мотив ARM M ; оранжевый, мотив ARM C . F , предполагаемый способ связывания FrdABCD с FliG cw , показывающий возможное участие петли Lys118-Pro137 (голубой) FrdB в контактах с С-концевым пучком из шести спиралей FliG cw .

Похожие статьи

  • Комплекс бактериального жгутикового переключателя становится все более сложным.

    Коэн-Бен-Лулу Г.Н., Фрэнсис Н.Р., Шимони Э., Ной Д., Давыдов Ю., Прасад К., Саги Ю., Чеккини Г., Джонстон Р.М., Айзенбах М. Коэн-Бен-Лулу Г.Н. и соавт. EMBO J. 9 апреля 2008 г .; 27 (7): 1134–44. doi: 10.1038/emboj.2008.48. Epub 2008 13 марта. ЭМБО Дж. 2008. PMID: 18337747 Бесплатная статья ЧВК.

  • Фумарат модулирует вращение бактериальных жгутиков, снижая разницу свободной энергии между состояниями мотора по часовой стрелке и против часовой стрелки.

    Прасад К., Каплан С.Р., Айзенбах М. Прасад К. и др. Дж Мол Биол. 1998 г., 31 июля; 280 (5): 821-8. дои: 10.1006/jmbi.1998.1922. Дж Мол Биол. 1998. PMID: 9671552

  • Химерный N-концевой белок Escherichia coli — C-концевой Rhodobacter sphaeroides FliG поддерживает двунаправленное вращение жгутиков E. coli и хемотаксис.

    Морхаус К.А., Гудфеллоу И.Г., Сокетт Р.Е.Морхаус К.А. и соавт. J Бактериол. 2005 март; 187(5):1695-701. doi: 10.1128/JB.187.5.1695-1701.2005. J Бактериол. 2005. PMID: 15716440 Бесплатная статья ЧВК.

  • Бактериальный жгутиковый мотор: структура и функция сложной молекулярной машины.

    Кодзима С., Блэр Д.Ф. Кодзима С. и др. Int Rev Cytol. 2004; 233:93-134. doi: 10.1016/S0074-7696(04)33003-2.Int Rev Cytol. 2004. PMID: 15037363 Рассмотрение.

  • Механизмы и динамика бактериального жгутикового мотора.

    Норд А.Л., Педачи Ф. Норд А.Л. и др. Adv Exp Med Biol. 2020;1267:81-100. doi: 10.1007/978-3-030-46886-6_5. Adv Exp Med Biol. 2020. PMID: 32894478 Рассмотрение.

Цитируется

1 артикул
  • Определение белковой активности у бактерий в регуляции метаболизма и подвижности.

    Альварадо А., Беренс В., Йосенханс К. Альварадо А. и др. Фронт микробиол. 2020 17 января; 10:3055. doi: 10.3389/fmicb.2019.03055. Электронная коллекция 2019. Фронт микробиол. 2020. PMID: 32010106 Бесплатная статья ЧВК. Рассмотрение.

Типы публикаций

  • Поддержка исследований, Национальный институт здравоохранения, заочная
  • Поддержка исследований, Ю.S. Gov’t, Non-P.H.S.

термины MeSH

  • Бактериальные белки / химия
  • Флуоресцентные красители / метаболизм
  • Молекулярно-динамическое моделирование
  • Сукцинатдегидрогеназа/метаболизм*

вещества

  • фумаратредуктазный комплекс

LinkOut — больше ресурсов

  • Полнотекстовые источники

  • Базы данных по молекулярной биологии

  • Разное

[Икс]

Укажите

Копировать

Формат: ААД АПА МДА НЛМ

Направление вращения жгутиков в оболочках бактериальных клеток

Клеточные оболочки с функциональными жгутиками, выделенные из штаммов Escherichia coli и Salmonella typhimurium дикого типа путем образования сферопластов пенициллином и последующего осмотического лизиса, демонстрируют вращение против часовой стрелки (CCW) при подаче энергии донором электронов для дыхания, DL-лактатом. Поскольку направление вращения жгутиков у бактерий играет центральную роль в выражении хемотаксиса, мы изучили причину этого отклонения. Нашими основными наблюдениями были: (i) сферопласты приобретали смещение по часовой стрелке (CW), если вместо лизиса их дополнительно инкубировали с пенициллином; (ii) репелленты временно вызывали вращение по часовой стрелке привязанных бактерий и сферопластов, но не производных от них клеточных оболочек; (iii) обесточивание бактерий cheV, вращающихся по часовой стрелке, с помощью KCN или обработки арсенатом вызвало смещение CCW; (iv) клеточные оболочки, выделенные из вращающихся по часовой стрелке мутантов cheC и cheV, сохраняли смещение CW, в отличие от оболочек, выделенных из мутантов cheB и cheZ, которые при высвобождении из цитоплазмы теряли это смещение и приобретали смещение CCW; и (v) направленный внутрь, искусственно индуцированный протонный ток вращал привязанные оболочки в направлении против часовой стрелки, но направленный наружу ток не мог вращать оболочки. Сделан вывод, что (i) цитоплазматическая составляющая необходима для экспрессии вращения по часовой стрелке (или репрессии вращения против часовой стрелки) в штаммах, не дефектных по переключателю; (ii) в отсутствие этого цитоплазматического компонента мотор необратим у таких штаммов и, вероятно, механически сужен так, что допускает вращение только против часовой стрелки; (iii) требование вращения по часовой стрелке для АТФ не на уровне мотора или переключателя, а на одном из предшествующих функциональных этапов механизма хемотаксиса; (iv) продукты генов cheC и cheV связаны с цитоплазматической мембраной; и (v) маловероятно прямое взаимодействие между системой переключения двигателей и репеллентными датчиками.

Flagella: Новый вид ритма

Многие организмы — от одноклеточных протистов до человека — полагаются на микроскопические волосовидные структуры, называемые ресничками и жгутиками, для выполнения широкого круга функций. Например, в дыхательной системе человека большое количество ресничек непрерывно работает над удалением грязи и патогенов из легких и дыхательных путей (Sims et al. , 2005): иногда они движутся вперед и назад в плоскости, а иногда следуют более сложная траектория (рис. 1А).Жгутики, как правило, крупнее ресничек, и многие одноклеточные организмы полагаются на хлестообразные биения жгутиков, чтобы продвигать их по воде, в которой они живут.

Биение жгутиков и ресничек.

( A ) Реснички и жгутики перемешивают жидкость, двигаясь вперед и назад в своей собственной плоскости (вверху) или вращательно (внизу).( B ) Жгутики одноклеточных организмов демонстрируют различные образцы биений, иногда в одной и той же клетке. Например, у динофлагеллят есть поперечный жгутик (красный), который закручивается по окружности клетки и распространяет спиральные волны, а также продольный жгутик, который движется вперед и назад за клеткой. ( C ) Водоросль Euglena gracilis имеет один короткий жгутик (внутри тела клетки) и один длинный жгутик, который содержит сердцевинную аксонему (белую) и паражгутиковый стержень (решетчатый рисунок). Когда две несовместимые структуры «склеиваются» друг с другом с помощью связующих звеньев (изображение справа), это создает механическое расстройство, которое заставляет обе структуры сгибаться вместе. В результате жгутик выгибается из плоскости и создает движение, похожее на лассо, которое тянет водоросль по винтовой траектории.

В центре большинства ресничек и жгутиков находится структура, называемая аксонемой, которая состоит из двух центральных микротрубочек внутри круга, образованного девятью парами микротрубочек.Моторные белки, такие как динеин, способны связываться с микротрубочками и создавать силы, заставляющие аксонему — и, следовательно, саму ресничку или жгутик — изгибаться. Комбинация механической обратной связи и активной передачи сигналов координирует действия моторных белков и через них общий паттерн биения. Разные организмы полагаются на разные вариации этого базового механизма, причем наибольшее разнообразие обнаружено у протистов (предположительно, потому, что один миллиард лет эволюции предоставил им широкие возможности для развития высокоспециализированных приспособлений ко многим экологическим нишам).

Одноклеточные организмы могут иметь несколько жгутиков, которые могут различаться (иногда резко) по длине и/или форме и даже сокращаться с разной частотой (рис. 1В). Например, водоросль под названием Euglena gracilis имеет два жгутика, в том числе один, который вращается как пропеллер или лассо перед клеткой и тянет ее в воде по спиральной траектории (Leedale et al., 1965). Многие протисты используют эту универсальную стратегию для сканирования окружающей среды (Cortese and Wan, 2021), но механизм, лежащий в основе лассоподобного движения жгутиков Euglena , остается загадкой.Теперь в eLife Джанкарло Чикконофри, Джованни Нозелли и Антонио Дезимоне, работающие в Международном центре числовых методов в инженерии, Международной школе перспективных исследований (SISSA) и Scuola Superiore Sant’Anna, сообщают, как взаимодействуют между собой аксонемы. и за это может быть ответственна необычная структура, называемая паражгутиковым стержнем (Cicconofri et al., 2021). Паражгутиковый стержень встречается только у определенных групп простейших, где он проходит параллельно аксонеме и имеет аналогичный диаметр (рис. 1С).Более того, он прикрепляется к специфическим местам на аксонеме посредством эластичных связей, что позволяет предположить, что он играет роль в подвижности (Melkonian et al., 1982).

Чикконофри и др. разработали подробную математическую модель жгутика, воспроизводящую противоположные физические свойства паражгутикового стержня и аксонемы. Модель показала, что, когда паражгутиковый стержень и аксонема «склеиваются» вместе, образуя единую структуру, результирующее механическое нарушение может привести к изгибу аксонемы из плоскости (рис. 1С).Затем исследователи продолжают показывать, что когда моторные белки динеина движутся таким образом, что вызывают простое плоское движение в отсутствие паражгутикового стержня, это вместо этого создает трехмерное движение, подобное лассо, и спиральное плавание, когда аксонема и паражгутиковый стержень склеены вместе. Обнаружив связь между парафлагелларным стержнем и жгутиковой подвижностью, Cicconofri et al. возможно, пришли к общему принципу создания сложной пространственно-временной динамики: сохранение простых основных принципов управления и использование несоответствующих механических свойств.

Растения также используют этот подход для достижения удивительного уровня скорости и маневренности. Например, волосовидная ость семян растения Erodium обернута жесткими целлюлозными волокнами, расположенными в виде наклонной спирали, которые помогают рассеивать семена, разматывая и скручивая ость в зависимости от влажности (Geer et al., 2020). . Аналогичная тесная связь существует между внутренним жгутиком и клеточным телом некоторых бактерий спирохет, что придает бактериям их спиралевидную форму и определяет их движение и вирулентность (Dombrowski et al., 2009).

Как и многие другие одноклеточные организмы, Euglena плавают по спиральным путям, чтобы сканировать окружающую среду (Rossi et al., 2017). В случае Euglena к этому добавляется фоторецепция, так что водоросль может эффективно перемещаться к свету или от него для фотосинтеза. Возможно, что паражгутиковый стержень может активно деформироваться и изменять характер биения жгутика в зависимости от интенсивности света (Piccinni, 1975), возможно, в сочетании с фоторецептором, расположенным в его основании (Rosati et al. , 1991). Математическая модель, разработанная Cicconofri et al. можно использовать для проверки этой гипотезы.

До сих пор остаются открытыми основные вопросы, например, как и когда развился паражгутиковый стержень и возник ли он сходным образом у разных видов (Lukes et al., 2009)? Например, паражгутиковый стержень также встречается у близкородственных организмов, называемых кинетопластидами, в число которых входят несколько паразитических жгутиконосцев, вызывающих инфекционные заболевания у людей. Euglena — полезная и универсальная модельная система для ответов на эти вопросы.Любопытные особенности, которые Euglena и другие одноклеточные организмы развили в течение миллиардов лет, могут быть применены к созданию интеллектуальных материалов в мягкой робототехнике. Это доказывает, что независимо от того, математик вы или биолог, природа продолжает вдохновлять.

границ | Динамическая ионная движущая сила, приводящая в действие жгутиковый двигатель бактерий

Введение

Некоторые бактерии передвигаются за счет вращения своих жгутиков (Berg and Anderson, 1973). Бактериальный жгутиковый двигатель (БЖМ) представляет собой мощную молекулярную наномашину в основании каждого жгутика, отвечающую за такое вращение. Один из немногих известных примеров биологических вращающихся машин, BFM уникален своей замечательной мощностью и эффективностью преобразования свободной энергии в механическую работу. Вращение жгутика управляется ионно-движущей силой (IMF), электрохимической разностью потенциалов, возникающей на мембране во время клеточного дыхания. Демонстрация того, что двигатель приводится в действие не энергией гидролиза АТФ, а потоком ионов через мембрану (Larsen et al., 1974; Manson et al., 1977) пришли через несколько лет после осознания того, что жгутики вращаются (Berg and Anderson, 1973). Учитывая источник энергии, который представляет собой заряженную квантованную частицу, движущуюся вдоль электрического поля, как экспериментальное, так и теоретическое рассмотрение возбуждения BFM является сложной задачей. Например, в физиологических условиях энергия, обеспечиваемая переносом одного иона, примерно в три раза меньше энергии, выделяемой при гидролизе АТФ. Как следствие, важные параметры, такие как размер элементарного шага и механизмы, такие как генерация силы, трудно решить экспериментально и смоделировать теоретически.Ионы движутся в соответствии как с электрическим, так и с концентрационным градиентом. МВФ определяется как сумма этих двух вкладов на

IMF=ΔΨ-2,3RTFΔpI    (1)

где ΔΨ = Ψ int −Ψ ext – разность мембранного потенциала Ψ, создаваемая совокупностью зарядов, разделенных мембраной, ΔpI=pIint-pIext=log[I]ext[I ]int — разность удельного ионного ( I ) потенциала, [ I ] — концентрация ионов, R — газовая постоянная, F — постоянная Фарадея, T — температура ( 2.3 RT / F ≃ 60 м В при T = 300 K ). IMF поддерживается вне равновесия в дышащих клетках с помощью трансмембранных (TM) комплексов, которые активно перекачивают ионы наружу через внутреннюю мембрану. Внешние ионы могут диффундировать и, наконец, падать вдоль энергетического потенциала, потребляемого BFM и другими комплексами TM, такими как АТФ-синтаза.

Несмотря на различия в ионной селективности и богатое разнообразие эволюционировавших структурных деталей (Rossmann and Beeby, 2018), основная структура BFM (см. рис. 1) хорошо сохранилась.В Escherichia coli ротор имеет диаметр около 45 нм и состоит из двух основных колец, встроенного во внутреннюю мембрану MS-кольца и цитоплазматического С-кольца. Ротор передает вращение жгутику через стержень, а затем внеклеточный крючок. Статор состоит из нескольких блоков, прикрепленных к пептидогликану (PG) на периферии ротора. Каждый узел статора действует как ионный канал, по которому перемещаются ионы и передают свою энергию для создания силы, вращающей ротор.Потребление ионов статорным блоком специфично: статорные блоки MotAB (например, в E. coli или Salmonella enterica ) потребляют клеточную протонную движущую силу (PMF), тогда как статоры PomAB (например, в Vibrio alginolyticus ) потребляют движущая сила ионов натрия (SMF) Sowa and Berry (2008). Важно отметить, что, по крайней мере, у энтеробактерий, таких как E. coli и S. enterica , статорные единицы не всегда связаны с двигательным комплексом, но наблюдается их динамический обмен между неактивным несвязанным состоянием и диффундированием во внутреннюю мембрану и двигательно-активное состояние (Leake et al., 2006). Более того, такой обмен является механочувствительным, так как двигатель может адаптировать количество связанных узлов статора в зависимости от внешней вязкостной нагрузки, включая до десятка (Lele et al., 2013; Tipping MJ et al., 2013; Chawla et al. , 2017; Nord et al., 2017; Terahara et al., 2017). Несколько исследований предполагают, что статоры также могут воспринимать IMF, и что сборка статора зависит от управляющего иона (Fukuoka et al., 2009; Tipping J. M. et al., 2013).

Рисунок 1 .Схема бактериального жгутикового двигателя (BFM) у грамотрицательных бактерий. Жгутиковая нить соединена с ротором (обозначен синим цветом) через крючок, универсальный шарнир и стержень, центральный приводной вал, который соединяет крючок с кольцом MS. Кольцо LP монтируется вокруг стержня и действует как втулка. Единицы статора связываются со слоем пептидогликана (PG), перемещают ионы из периплазмы в цитоплазму и создают крутящий момент, взаимодействуя с С-кольцом. IM, внутренняя мембрана; ОМ, наружная мембрана.Экспортный аппарат типа III не показан.

В этом обзоре мы представляем и обсуждаем некоторые основные результаты, которые проливают свет на динамический бактериальный IMF, в частности, в отношении структуры и активности жгутикового мотора и его статорных единиц.

Скорость BFM пропорциональна IMF

Понимание взаимосвязей между IMF, ΔΨ, Δ pI и двигательной активностью (измеряемой с помощью скорости плавания клеток или угловой скорости и крутящего момента отдельных двигателей) представляет большой интерес, особенно потому, что оно обеспечивает точные ограничения для физико-механических модели мотора.К сожалению, построение убедительной общей схемы того, как двигательная активность зависит от компонентов IMF, затруднено зависимостью мембранных и ионных потенциалов от внутреннего клеточного гомеостаза, большой межклеточной изменчивостью и различиями между штаммами. Измерение активности отдельных моторов в контролируемых условиях помогает получить полное распределение поведения.

Естественным параметром, который следует варьировать при изучении поведения двигателя как функции IMF, является концентрация связывающего иона во внешней среде, влияющая на pI ext , как показано на рисунке 2 для трех опубликованных работ.Для моторов, потребляющих протоны (например, E. coli, B. subtilis, Streptococcus ), изменение pH доб влияет не только на двигательную активность, но и на ряд других клеточных механизмов. Это приводит к связи между компонентами PMF. У B. subtilis (рис. 2А) (Shioi et al., 1980) и E. coli (рис. 2В) (Minamino et al., 2003) увеличение pH ext сопровождается увеличением pH int (линейное по E.Coli , с насыщенностью в B. subtilis ), с рН int 3 pH > pH Ext до рН Ext ~ 7. 5. При уменьшении Δ pH ΔΨ компенсаторно увеличивается, в результате чего PMF изменяется не резко (в пределах ~ 50 мВ) в диапазоне pH вн = 5–8. Связи между pI ext и ΔΨ удалось избежать путем выражения химерных статоров, управляемых Na + , в E.coli (Lo et al., 2007) (рис. 2C). В этом случае изменение pNa ext очень мало влияет на ΔΨ. Следовательно, SMF следует за δ PNA , уменьшается с увеличением PNA Ext , учитывая, что PNA int увеличивается менее быстро, чем PNA Ext . Кроме того, pH ext также можно использовать для управления SMF, так как он линейно влияет на ΔΨ, но почти полностью отделен от Δ pNa .

Рисунок 2 . Схематическое соотношение между ΔΨ, Δ pI , IMF (верхние панели) и pI int (нижние панели) в зависимости от концентрации внешних ионов. Графики воспроизведены из данных, опубликованных в (A) (Shioi et al., 1980), для потребляющего протон мотора B. subtilis , (B) Minamino et al. (2003), для потребляющего протон двигателя E. coli и (C) Lo et al.(2007) для потребляющего натрий химерного двигателя E. coli , использующего химерные статоры Na + . Две крайние правые панели в (C) схематично показывают эквивалентность компонентов SMF при высокой нагрузке (вверху) и их неэквивалентность (нижняя панель, см. текст).

В управляемом Na + химерном двигателе E. coli при высокой нагрузке скорость двигателя линейно пропорциональна SMF с эквивалентной зависимостью от ΔΨ (управляется pH ext ) и Δ pNa (контролируется pNa доб ).При более низкой нагрузке (гранулы 0,35 мкм) эквивалентность между двумя компонентами нарушается (рис. 2C, правые панели). Например, если ΔΨ уменьшить, а Δ pNa увеличить так, чтобы поддерживать постоянное значение SMF, наблюдается увеличение скорости двигателя. Неэквивалентность графически показана в пространстве (Δψ, Δ pNa , ω) на рисунке 2C: : при высокой нагрузке та же скорость (красная точка) может быть достигнута путем увеличения либо Δψ, либо Δ pNa , при низкой нагрузке это уже не так (красные точки), поскольку наклон ω, рассматриваемый как функция одного компонента, зависит от другого компонента.Ведущей гипотезой, объясняющей эту неэквивалентность, является то, что лимитирующей стадией при низкой нагрузке и низких условиях [Na + ] ext является диффузионно-ограниченное связывание ионов Na + с узлами статора ( Ло и др., 2007).

Несмотря на некоторые описания нелинейностей (порог, насыщение и неэквивалентность компонентов ММП; Khan and Macnab, 1980; Shioi et al., 1980; Lo et al., 2007), отражающие сложность измерений и их интерпретация, многочисленные результаты способствуют общему мнению о том, что существует линейная зависимость между скоростью двигателя и IMF. В таблице 1 приведены некоторые из опубликованных работ, описывающих эту пропорциональность и диапазон IMF, для которого она сохраняется, охватывающий физиологический диапазон. В Ло и соавт. (2007), авторы исследовали скорость двигателя на блок статора в двигателях с питанием от Na + и обнаружили, что линейная зависимость между скоростью и IMF сохраняется на уровне отдельного блока статора. Однако пропорциональность нарушается при закислении цитоплазмы, по крайней мере, у моторов с двигателем H + .В присутствии слабой кислоты (которая диссоциирует при пересечении цитоплазматической мембраны, понижая pH int и частично разрушаясь Δ pH ) уменьшение pH ext с приводит к к общему снижению PMF всего на ~ 10 мВ, но вызывает сильное снижение скорости двигателя. На основании этих результатов была выдвинута гипотеза, что высокая внутренняя концентрация протонов препятствует отсоединению протонов от статоров в цитозоле, нарушая их функцию (Minamino et al. , 2003). Таким образом, двигатель, по-видимому, реагирует на весь IMF, если только pH int не будет существенно снижен (Gabel and Berg, 2003).

Таблица 1 . Опубликованные диапазоны линейности между скоростью двигателя ω и ионно-движущей силой (IMF) при различных нагрузках.

При рассмотрении линейности между IMF и скоростью следует также иметь в виду соответствующий масштаб времени. Из-за технических ограничений, в основном при динамическом измерении ММП, линейная зависимость была экспериментально продемонстрирована только на низкой частоте, т.е.е., в средних по ансамблю ω и IMF, полученных за относительно длительные периоды времени. Хотя теперь можно измерить ω с разрешением ~ 10 мс в анализах шариков, IMF часто измеряется в масштабе от нескольких секунд до минут и часто усредняется по всей клеточной популяции. Однако по крайней мере двум методам удалось напрямую и динамически манипулировать IMF. Применяя переменное внешнее напряжение непосредственно к захваченной и пермеабилизированной клетке внутри микропипетки, линейность между ω и IMF была продемонстрирована с разрешением в несколько секунд (Fung and Berg, 1995). Путем экспрессии и возбуждения протеородопсина протонного насоса для запуска оттока протонов (Walter et al., 2007; Tipping J.M. et al., 2013) можно динамически возмущать IMF (хотя и не измерять) при измерении ω с разрешением менее секунды. Ниже мы обсудим последние методы динамической количественной оценки IMF. При наблюдении скорости двигателя и IMF на более высокой частоте (т. е. усреднение по временным интервалам менее секунды) анализ усложняется флуктуациями, и определение взаимосвязи между быстрыми колебаниями IMF и быстрыми изменениями скорости остается сложной задачей.Наконец, как обсуждается ниже, динамическая сборка и замена статора также должны учитываться (или контролироваться) при изучении взаимосвязи между IMF и скоростью.

Наблюдение, что поток ионов через двигатель прямо пропорционален скорости, вместе с линейной зависимостью между IMF и скоростью способствовали созданию широко используемой модели, в которой перемещение ионов тесно связано с вращением, т. е. фиксированное число ионов дает фиксированное угловое смещение (Manson et al. , 1980; Meister et al., 1987). Линейность скорости IMF является необходимым условием для модели сильной связи, и она была подтверждена несколькими измерениями, как описано выше. Однако это не является достаточным условием. Учитывая ее важность для механистического моделирования BFM, а также других микробиологических механизмов (например, механосенсорного восприятия и инициации биопленки; Belas, 2013), гипотеза тесной связи требует дальнейшего изучения, в идеале на уровне одного двигателя.

Узел статора

чувствителен к IMF

Вопреки давнему предположению, что после сборки структура BFM была статичной, теперь хорошо известно, что несколько компонентов двигателя динамически заменяются.Наиболее хорошо изученным примером этого являются статорные единицы, которые обмениваются между активной формой, связанной с мотором, и неактивной формой, распространяющейся через мембрану, во временной шкале от секунд до минут (Leake et al., 2006). Скорость обмена и число статоров в установившемся режиме зависят от вязкостной нагрузки на двигатель (Леле и др. , 2013 г.; Типпинг М.Дж. и др., 2013 г.; Чавла и др., 2017 г.; Норд и др., 2017 г.). ), свойство, которое позволяет бактерии приспосабливаться к изменениям местной вязкости. Однако есть несколько признаков того, что замена и сборка статора чувствительны не только к местным механическим условиям, но и к местным электрохимическим условиям.Такая способность позволила бы штаммам, которые соединяют несколько ионов через отдельные статоры, настраивать состав своих двигателей в соответствии с преобладающими условиями (Thormann and Paulick, 2010).

Одним из первых экспериментов, позволивших предположить, что сборка статора чувствительна к IMF, был эксперимент Фунга и Берга с микропипеткой (Fung and Berg, 1995). Как только нитевидная клетка E. coli была помещена в микропипетку, они рассеяли PMF через ионофор, который, как и ожидалось, остановил вращение двигателя.Но когда мембранное напряжение было восстановлено, они наблюдали задержку перед тем, как двигатели начали вращаться, после чего скорость увеличивалась ступенчато. Это предполагало, что блоки статора каким-то образом инактивировались при разрушении ВМП, а затем индивидуально реактивировались или собирались заново при восстановлении ВМП. В попытке сохранить количество блоков статора постоянным при оценке линейности между скоростью и IMF авторы избежали полного коллапса PMF, поддерживая ненулевое напряжение постоянного тока. Однако в более поздних экспериментах по работе двух двигателей на одном и том же E зависимость статора от IMF была менее очевидной.coli при медленном коллапсе ММП. Два двигателя достигли нулевой скорости в одно и то же время, что потенциально позволяет предположить, что блоки статора не диссоциировали или не дезактивировались при исчезновении IMF (Gabel and Berg, 2003), хотя низкое временное разрешение (~ 5 с) оставляет место для неопределенности.

Типпинг Дж. М. и др. (2013) использовали статоры, меченные флуоресцентным белком (FP), чтобы показать, что при коллапсе PMF в E. coli статоры отделяются от двигателя в течение нескольких минут. Однако эти результаты противоречат результатам двух отдельных исследований, в которых также с использованием статоров с меткой FP отмечается, что PMF не является необходимым для сборки статора ни у S. enterica , ни у E. coli (Morimoto et al., 2010). ; Судзуки и др., 2019). Хотя кажется хорошо установленным, что компонент ΔpH PMF не является необходимым для сборки в E. coli или S. enterica (Fung and Berg, 1995; Morimoto et al., 2010; Suzuki et al., 2019). , недавняя работа показала, что сборка увеличивается при более низком внешнем pH (Suzuki et al., 2019). Таким образом, концентрация доступных протонов оказывается более важной, чем градиент через мембрану. Тем не менее, как ни странно, мутация консервативного протонируемого остатка в MotB, которая делает статор нефункциональным, показала, что транслокация протона не является необходимой для сборки статора у E. coli или S. enterica (Zhou et al., 1998; Kojima and Blair, 2001; Morimoto et al. , 2010; Suzuki et al., 2019).

Для статора Na + требуется SMF для сборки в В.alginolyticus (Fukuoka et al., 2009), и, в отличие от статора H + , проводимость Na + также требуется для сборки в V. alginolyticus и B. subtilis (Fukuoka et al., 2009). ; Терахара и др., 2017). И хотя концентрация внешнего Na + имеет решающее значение для сборки статора у V. alginolyticus, B. subtilis и управляемого Na + гибридного статора у E. coli (Fukuoka et al., 2009; Сова и др., 2014; Terahara et al., 2017), в сборке Na + -статор в S. oneidensis нет необходимости (Paulick et al., 2015).

Мы обобщаем проведенные на сегодняшний день исследования, в которых исследуются связанные с ионами условия, необходимые для сборки статора, в Таблице 2. Пока еще нет согласованной универсальной картины обнаружения ионов в статоре; как и в случае с другим поведением, оно может оказаться зависимым от иона и вида, хотя внешняя концентрация связывающего иона кажется в целом важной. Остается показать, связано ли это со способностью статора обнаруживать ионы.В качестве альтернативы, если связывание статора с PG стабилизируется силой (Chawla et al., 2017; Nord et al., 2017), может быть просто так, что увеличение концентрации ионов и скорости ионной проводимости увеличивает в среднем стабильность. связи статор-PG. Тот факт, что ионная проводимость не требуется для сборки статора H + , противоречит этому объяснению в случае статора H + .

Таблица 2 . Показано, что ионно-движущая сила (IMF) и условия, связанные с ионами, необходимы, ✓, или нет, ✗, для сборки статора.

Исследования, которые показали, что скорость двигателя и скорость одиночного статора линейно зависят от IMF, по-видимому, имеют смысл только при условии, что количество собранных статоров постоянно. Таким образом, тот факт, что сборка статора каким-то образом, который еще предстоит определить, зависит от IMF, усложняет интерпретацию линейной зависимости скорости от IMF. Существует неразрешенное противоречие, так как линейная зависимость между IMF и скоростью не должна наблюдаться, если одновременно увеличиваются и число статоров, и скорость на один статор.Это может свидетельствовать о том, что зависимость между номером статора и IMF является сублинейной, и что разборка статора в основном происходит только при очень низких значениях IMF. Будущие исследования динамики статора как функции IMF будут ключом к пониманию того, как эти части сочетаются друг с другом.

Ионная специфичность

У большинства бактерий статоры питаются от одного вида катионов, чаще всего протонов или ионов натрия. Обычно статоры типа MotAB имеют соединение H + , а статоры типа PomAB и MotPS имеют соединение Na + .Тем не менее, некоторые бактерии способны связывать несколько типов катионов. Одним из способов достижения этого является использование нескольких наборов генов, которые кодируют несколько типов статорных комплексов. Например, B. subtilis, V. alginolyticus и S. oneidensis кодируют как статор MotAB, управляемый H + , так и статор MotPS или PomAB, управляемый Na + (Atsumi et al., 1992). ; Asai et al., 2000; Ito et al., 2005; Paulick et al., 2009). У V. alginolyticus статоры PomAB конститутивно экспрессируются и приводят в действие мотор полярных жгутиков, тогда как статоры MotAB экспрессируются только при определенных условиях окружающей среды и исключительно питают моторы латеральных жгутиков (Belas et al., 1986; МакКартер и др., 1988 г.; Атсуми и др., 1992; Кавагиши и др., 1995). В B. subtilis и S. oneidensis оба типа статоров являются конститутивными. Они включаются в один двигатель, работая в унисон, хотя их близость к двигателю зависит от химических и физических условий окружающей среды (Ito et al., 2005; Paulick et al., 2009). Систематический обзор бактериальных геномных данных показал, что по крайней мере 65 видов бактерий обладают двумя или более предполагаемыми статорами (Thormann and Paulick, 2010). Другие виды связывают несколько катионов через единый статорный комплекс. Например, статор MotAB Bacillus clausi может соединять либо H + , либо Na + (Terahara et al., 2008), а MotPS в Bacillus alcalophilus пары Na + , K

9 или Rb

+ (Terahara et al., 2012). Хотя сообщалось, что MotAB в Paenibacilus sp. был уникален своей способностью связывать двухвалентные катионы Mg 2+ и Ca 2+ (Imazawa et al., 2016), недавние результаты показывают, что этот статор на самом деле питается одновалентными ионами, вероятно, протонами (Onoe et al., 2020). Независимо от связывающего иона считается, что универсально консервативный остаток аспартата на N-концевой стороне TM-области MotB (D32 в E. coli ) служит местом связывания иона (Zhou et al., 1998). .

Многие гибридные статоры были созданы для того, чтобы исследовать вопрос о том, что в статоре определяет специфичность ионов. Ранние работы показали, что комбинация MotA ( R. Sphaeroidis ) и PomB ( V. alginolyticus ) произвели статор с приводом от Na + в V. alginolyticus . Этот гибрид нуждался в белках MotX и MotY, чтобы функционировать, компоненты, которые необходимы для включения PomAB в V. alginolyticus (Terashima et al., 2013). Эта работа исключила субъединицу А как компонент, определяющий ионы (Asai et al., 1999). Было показано, что в B. subtilis гибридные статоры MotAS и MotPB связаны Na + и H + , соответственно, что позволяет предположить, что субъединица B/S является доминирующим фактором, определяющим ионную селективность (Ito et al., 2005). Однако было замечено, что субъединицы MotA и MotP придают чувствительность H + или Na + , соответственно (Ito et al., 2005). Это говорит о том, что либо А/Р-субъединица играет второстепенную роль в ионной специфичности, либо, учитывая приведенные выше данные о восприятии статора IMF, возможно, что А/Р-субъединица является определяющим фактором H + и Na + — зависимый узел статора. Также недавно было высказано предположение, что субъединица P имеет решающее значение для селективности ионов K + в B.alcalophilus и Bacillus trypoxylicola (Naganawa and Ito, 2020).

Чтобы выяснить, какая часть субъединицы В определяет ионную специфичность, химерная субъединица, названная MomB, была сконструирована из N-концевой части MotB ( R. Sphaeroidis ) и С-концевой части PomB ( V. alginolyticus). ). MomB и PomA продуцировали статор Na + в V. alginolyticus , и интересно, положение соединения MotB/PomB в консервативной области TM влияло на специфичность Na + /Li + .Таким образом, была выдвинута гипотеза, что периплазматическая область PomB, расположенная проксимальнее внутренней мембраны, играет роль в ионной специфичности, возможно, путем изменения размера пор TM (Asai et al., 2000). Определенные конструкции MomB также продуцируют управляемый Na + статор с MotA в V. alginolyticus , хотя его функция зависела от присутствия MotX и MotY (Asai et al. , 2000, 2003). Обратная конструкция, N-конец PomB в сочетании с C-концом MotB, названный PotB, функционировал с PomA как статор с питанием от Na + при В.alginolyticus или E. coli независимо от присутствия MotXY (Asai et al., 2003). Таким образом, хотя периплазматическая часть PomB не является необходимой для соединения Na + в статоре PomAB, достаточно преобразовать статор MotAB из H + — в соединение Na + .

Мутации вблизи поверхности консервативного сегмента TM субъединицы B могут привести к тому, что статор двухионной связи B. clausi будет предпочитать либо H + , либо Na + , а мутации в той же области могут придавать двухионная связывающая способность до 90×103 Б.subtilis статоров (Terahara et al., 2008). Единственная мутация в TM-области MotS B. alcalophilus изменила его с многоионного связывания на одноионное связывание (Terahara et al., 2012). Выравнивание последовательностей показало, что статоры MotB, связанные с H + , из многих бактерий содержат консервативный валин в середине сегмента TM (остаток 43 в E. coli ), тогда как статоры PomB и MotS, связанные с Na + , содержат консервативный лейцин в этом положении и Na + /K + /RB + -связанный MotS B.alcalophilus содержит метионин (Terahara et al., 2012). Управляемое молекулярно-динамическое моделирование атомной модели MotAB, построенной на основе дисульфидного перекрестного связывания и мутаций сканирования триптофана, показало, что размер ионного канала в его самом узком месте был чувствителен к мутациям в этом остатке ТМ, что предполагает исключение размера как механизм для иона. -селективность (Nishihara and Kitao, 2015).

Недавно структура статора была определена с помощью криоэлектронной микроскопии (Deme et al., 2020; Сантивери и др., 2020). На рисунке 3А показаны фрагменты множественного выравнивания последовательностей, первоначально выполненного с помощью программы выравнивания Clustal Omega (Madeira et al., 2019), затем уточненного и отредактированного с помощью ViTO (Catherinot and Labesse, 2004) с учетом опубликованных структур. (PDB: 6YKP, 3S0Y). Эти выравнивания выделяют дифференциально консервативные остатки внутри трансмембранной спирали (TMH) MotB, но они также идентифицируют множественные дифференциально консервативные остатки в TMh4 и TMh5 Mot/PomA, которые картируются на границе раздела A/B, которая очень компактна и в значительной степени гидрофобна в его самая центральная часть (Deme et al., 2020; Сантивери и др., 2020). Дифференциально консервативные остатки обычно располагаются в трех кольцах, как показано на рисунке 3B, без плотных связей. Рядом с периплазматическим интерфейсом остаток EcMotB V43 сталкивается с остатками EcMotA I202 и EcMotA A187 внутри TMh5 и TMh4 соответственно (рис. 3C). Хотя это кольцо полностью скрыто и соответствует гидрофобным заменам, различия между статорами H + и Na + здесь могут привести к общему изменению размера или гибкости области, как предполагалось ранее (Nishihara and Kitao, 2015).Далее в канал остатки MotB Y30 и MotB F33 сталкиваются с остатками 178–181 MotA TMh4, и с большей доступностью это представляет собой еще одну область, которая может контролировать ионную специфичность (рис. 3D). Замены в этом кольце повлияют на сеть взаимодействий, включающих водородные связи с незаменимым аспартатом MotB D32 . Действительно, ранее отмечалась несовершенная корреляция между остатком 30 MotB и ионной специфичностью (Ishida et al., 2019; Islam et al., 2020), и может оказаться, что отбор частично зависит от обращенной к TMh4 области.Наконец, остатки 217–219 MotA TMh5 сталкиваются с консервативным остатком MotB W26 (рис. 3), который образует Н-связь с MotA Y217 в моторах H + . Вместо этого в натриевых статорах MotP/PomA наблюдается меньший по размеру и более гибкий аспарагин. Поскольку мутация MotB W26A устраняет подвижность (Deme et al., 2020), этот контакт важен, хотя мы не видим очевидного механизма селекции ионов в этой открытой области.

Рис. 3. (A) Выравнивание последовательностей нескольких видов субъединиц статора A и B.Выделение означает сохранение > 70% либо для всех видов (желтый), либо по-разному только для статоров H + или Na + (синий и красный соответственно; ион связи C. sporogenes остается неясным). Остатки, упомянутые в тексте, которые соответствуют одному из трех колец дифференциально консервативных остатков, обведены зеленым, а соответствующее кольцо указано внизу. (B) Статор, вид сбоку, показаны два узла MotB и три из пяти узлов MotA (показаны боковые цепи для узлов MotB и двух узлов MotA).Три кольца дифференциально консервативных остатков отмечены зелеными прямоугольниками. (C) Вид снизу (вид из цитоплазмы) кольца 1. (D) Вид снизу кольца 2. (E) Вид снизу кольца 3.

Пространственно-временные вариации ММП на уровне клеток и популяций

Электрохимический градиент через мембрану бактериальной клетки играет центральную роль не только в подвижности, но и в других физиологических процессах синтеза АТФ (Mitchell, 1961; Maloney et al., 1974) к делению клеток (Strahl, Hamoen, 2010; Chimerel et al., 2012). По этой причине он традиционно считался гомеостатическим. Однако недавняя работа показала, что IMF может быть динамическим, неразрывно связанным с физиологическим состоянием клетки и играющим роль в передаче информации. Недавно было показано, что IMF-опосредованные внутри- и межклеточные электрические сигналы регулируют физиологические процессы, такие как механоощущение и метаболическая координация, иногда на больших расстояниях, как внутри, так и между сообществами (Liu et al., 2015; Бруни и др., 2017). Мы обсудим здесь несколько примеров, где наблюдались пространственно-временные вариации IMF, как на уровне отдельной клетки, так и на уровне популяции.

В качестве новаторской работы в бурно развивающейся области бактериальной электрофизиологии Kralj et al. (2011) разработали чувствительный к напряжению флуоресцентный мембранный белок (PROPS) для исследования динамики напряжения на уровне отдельной клетки. Они заметили, что, хотя клетки демонстрируют большую гетерогенность в поведении, многие клетки демонстрируют квазипериодические колебания напряжения на своей мембране. Как и ожидалось, эти преходящие деполяризации коррелировали с преходящим снижением скорости движения. В то время физиологическая роль электрических импульсов была неясна; поскольку на интенсивность и частоту влияла мощность визуализирующего лазера, авторы предположили, что такие колебания могут быть признаком реакции бактериального стресса. Когда PROPS комбинировали с генетически кодируемым кальциевым сенсором, было замечено, что транзиторная деполяризация мембран вызывает транзиторный приток кальция, напоминающий потенциалы действия нейронов (Bruni et al., 2017). Доказательством того, что такое явление является сигнатурой передачи сигналов, стало наблюдение, что переходный индуцированный напряжением приток Ca + увеличивался при механической стимуляции, и что такая стимуляция приводила к изменениям концентрации белка на уровне отдельных клеток (Bruni et al. , 2017).

Недавно было показано, что динамика IMF важна для прикрепленных к поверхности сообществ бактерий, называемых биопленками. На уровне популяции система с несколькими электродами показала, что интенсивность электрической активности коррелирует с образованием биопленки (Masi et al., 2015). С разрешением на уровне одной клетки было показано, что биопленки производят пространственно распространяющиеся волны колеблющегося мембранного потенциала и что эти волны коррелируют с распространяющимися волнами внеклеточного калия. Имеются существенные доказательства в поддержку модели, в которой деполяризация мембраны запускается метаболическим стрессом внутри биопленки, который запускает высвобождение внутриклеточного K + , который впоследствии деполяризует соседние клетки. Таким образом, мембранный потенциал используется для проведения дальнодействующих электрических сигналов для координации метаболических состояний в растущей биопленке, тем самым повышая приспособленность биопленки в целом (Prindle et al., 2015). Сигналы, передаваемые этими распространяющимися волнами калия, выходят за пределы сообщества биопленки. Пространственно разделенные биопленки могут извлекать выгоду из этого электрохимического сигнала для координации поведения потребления ресурсов с разделением времени (Liu et al., 2017), а плавательное поведение удаленных планктонных клеток может быть изменено таким образом, чтобы рекрутировать клетки для присоединения к биопленке. Хотя большая часть этой работы была выполнена на B. subtilis , механизмы вполне могут быть общими для бактерий; электрическая сигнализация от B.subtilis привлекает плавающие клетки из эволюционно далекого P. aeruginosa (Humphries et al., 2017).

По-видимому, существует большая межклеточная гетерогенность как в стационарном, так и в динамическом поведении клеточного IMF (Kralj et al., 2011). Недавние данные показали, что как стационарное напряжение мембраны, так и динамическое поведение в ответ на электрическую стимуляцию зависят от пролиферативной способности клетки (Stratford et al., 2019). Кроме того, электрическая поляризация клетки играет роль в успешном образовании спор (Sirec et al. , 2019). Хотя может показаться, что такая неоднородность от клетки к клетке может мешать передаче электрических сигналов на большие расстояния, модель, основанная на теории перколяции, предполагает, что количество клеток, способных передавать электрический сигнал, согласуется с предсказанным фазовым переходом. Таким образом, плотная биопленка, состоящая из гетерогенной смеси сигнальных и несигнальных клеток, способна распространять сигналы на большие расстояния при минимальных затратах на уровне одной клетки (Larkin et al., 2018).

Измерения IMF с одной ячейкой

В то время как развивающаяся область бактериальной электрофизиологии черпает вдохновение из передовой области эукариотической электрофизиологии, уменьшенный размер бактериальной клетки и сложность мембраны создают новые проблемы. Методы, применяемые при изучении эукариотических клеток, такие как подходы с микроэлектродами и пэтч-клампами, до сих пор остаются непрактичными, не имеют разрешения для отдельных клеток (Masi et al. , 2015) или требуют больших физических возмущений (Martinac et al., 2008). В то время как бактериальная биоэнергетика исторически исследовалась с помощью измерений общей популяции (Kashket, 1985), новые методы позволяют измерять как электрические, так и химические компоненты IMF на уровне отдельной бактериальной клетки.

Измерения ΔΨ чаще всего выполняются с помощью датчиков Нернста (Lo et al., 2006, 2007; Kralj et al., 2011; Prindle et al., 2015; Sirec et al., 2019; Stratford et al., 2019; Mancini). et al., 2020), небольшие флуоресцентные молекулы, диффундирующие через мембрану в соответствии с уравнением Нернста.Флуоресцентные измерения отношения внеклеточной к внутриклеточной концентрации при равновесии сообщают о ΔΨ. Однако их проницаемость для грамотрицательных бактерий низкая, что приводит к медленному динамическому ответу (~ минут), и поэтому они не подходят для регистрации быстрых колебаний ΔΨ. Кроме того, хотя для улучшения соотношения сигнал-шум желательны высокие концентрации, повышение концентрации нернстовских красителей фактически возмущает мембранное напряжение (Sirec et al. , 2019; Mancini et al., 2020). Таким образом, их применение требует тщательной калибровки (Mancini et al., 2020). Как упоминалось выше, альтернативой зонду ΔΨ является генетически кодируемый датчик напряжения, называемый PROPS, созданный из поглощающего зеленый цвет протеородопсина (Kralj et al., 2011; Bruni et al., 2017). PROPS обеспечивает значительно более быстрый временной отклик (~ 10 мс; Kralj et al., 2011) без необходимости этапа загрузки красителя, хотя и за счет более низкого отношения сигнал/шум.

Для измерения химического компонента IMF требуется репортер для внутриклеточной концентрации связывающего иона.Внутриклеточный рН сначала определяли количественно на уровне отдельных клеток с использованием проницаемых для мембран рН-зависимых флуоресцентных красителей (Siegumfeldt et al., 2000; Rasmussen et al., 2008; Kurre et al., 2013; Chao et al., 2017). В более позднем подходе, который устраняет необходимость этапа загрузки красителя и его потенциальных инвазивных эффектов (Han and Burgess, 2010), используются генетически кодируемые флуоресцентные белки, такие как pH-чувствительные производные GFP (Miesenböck et al. , 1998; Martinez). et al., 2012; Kurre et al., 2013; Morimoto et al., 2016; Рупрехт и др., 2017; Арсе-Родригес и др., 2019). Помимо отличного разрешения по времени (<1 с) и pH (<0,1) (Kralj et al., 2011), слияние pHluorin и FliG BFM показало локальные измерения pH с субклеточным пространственным разрешением (Morimoto et al. , 2016). PHluorin также можно комбинировать с PROPS для одновременного измерения ΔpH и мембранного потенциала отдельных клеток (Kralj et al., 2011; Bruni et al., 2017). Количественные измерения внутриклеточного натрия в отдельных клетках были продемонстрированы с использованием проницаемых для мембран флуоресцентных красителей Na + и применены к исследованиям гибридного Na + -управляемого двигателя E.coli (Lo et al., 2006, 2007; Minamino et al., 2016). Относительные измерения цитоплазматического Ca 2+ были продемонстрированы в E. coli с помощью генетически кодируемого флуоресцентного датчика Ca 2+ (Bruni et al. , 2017).

Тот факт, что скорость BFM пропорциональна IMF, дает интригующую возможность использовать его в качестве устройства для измерения IMF связанного иона. Недавно было показано, что BFM E. coli может измерять динамические изменения PMF во время кратковременного воздействия ионофора, а также динамическое фотоповреждение клеточной мембраны, индуцированное светом (Krasnopeeva et al., 2019). Поскольку временное разрешение таких измерений теоретически ограничено только скоростью сбора данных и временем релаксации частицы, прикрепленной к жгутиковой нити (~ мс), BFM представляет собой захватывающий инструмент будущего для количественного изучения быстрой электрофизиологической динамики на отдельной клетке. уровень. Однако, как подчеркивалось выше, на такие измерения будет влиять стохастическая динамика статора, а также другие факторы, такие как опосредованное вторичным мессенджером связывание цитоплазматического белка YcgR с ротором, что замедляет скорость двигателя в E. coli (Boehm et al., 2010; Fang and Gomelsky, 2010; Paul et al., 2010).

Перспективы

У видов, исследованных до сих пор, скорость BFM линейна с IMF. Остается полностью выяснить, когда и в какой степени сборка статора зависит от IMF, а также лежащий в основе механизм этого электрического или химического восприятия. В будущей работе также потребуется расшифровать, как возникает линейность между скоростью и IMF, если и скорость одиночного статора, и сборка статора пропорциональны IMF.Такие детали будут способствовать созданию моделей все еще неуловимого механизма создания крутящего момента, чему в значительной степени будут способствовать недавно решенные структуры комплекса статора (Deme et al., 2020; Santiveri et al., 2020). Эти структуры также откроют путь для будущих симуляций, чтобы пролить свет на специфичность ионов и ионно-зависимую сборку.

Благодаря недавним достижениям в методах электрофизиологии одиночных клеток, эта область готова многое узнать о динамике IMF и ее внутренней связи с разнообразными физиологическими процессами в масштабах от одного двигательного комплекса до целой колонии бактерий. По иронии судьбы одним из лучших инструментов для исследования динамики ММП может быть двигатель, который ее потребляет; тем не менее, наше понимание МВФ и уровня его потребления BFM остается неполным.

Вклад авторов

AB-B, FP, GL и AN провели исследование и написали этот обзор. Все авторы внесли свой вклад в статью и одобрили представленную версию.

Финансирование

Эта работа была поддержана грантом проекта ANR FlagMotor ANR-18-CE30-0008 французского Agence Nationale de la Recherche и Французской инфраструктурой комплексной структурной биологии (FRISBI) ANR-10-INBS-0005.CBS является членом France-BioImaging (FBI) и Французской инфраструктуры комплексной структурной биологии (FRISBI), двух национальных инфраструктур, поддерживаемых Национальным исследовательским агентством Франции (ANR-10-INBS-04-01 и ANR-10- ИНБС-05 соответственно).

Конфликт интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Ссылки

Арсе-Родригес, А., Volke, D.C., Bense, S., Häussler, S., and Nikel, P.I. (2019). Неинвазивное логометрическое определение внутриклеточного pH у видов Pseudomonas с использованием нового генетически кодируемого индикатора. Микроб. Биотехнолог . 12, 799–813. дои: 10.1111/1751-7915.13439

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Асаи Ю., Кавагиши И., Сокет Р. Э. и Хомма М. (1999). Гибридный двигатель с приводными компонентами H + и Na + может вращать полярные жгутики Vibrio с помощью ионов натрия. Дж. Бактериол . 181, 6332–6338. doi: 10.1128/JB.181.20.6332-6338.1999

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Асаи Ю., Кавагиши И., Сокет Р. Э. и Хомма М. (2000). Сопряжение ионной специфичности химер между H + — и Na + -управляемыми моторными белками, MotB и PomB, в полярных жгутиках Vibrio. EMBO J . 19, 3639–3648. doi: 10.1093/emboj/19.14.3639

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Асаи Ю., Якуши Т., Кавагиши И. и Хомма М. (2003). Детерминанты ионной связи Na + -управляемого и H + -управляемого жгутиковых моторов. Дж. Мол. Биол . 327, 453–463. doi: 10.1016/S0022-2836(03)00096-2

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Атсуми Т., Маккартер Л. и Имаэ Ю. (1992). Полярный и латеральный жгутиковые моторы морских вибрионов приводятся в действие разными ионно-движущими силами. Природа 355, 182–184. дои: 10.1038/355182a0

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Белас Р., Саймон М. и Сильверман М. (1986). Регуляция транскрипции генов боковых жгутиков у Vibrio parahaemolyticus . Дж. Бактериол . 167, 210–218. doi: 10.1128/JB.167.1.210-218.1986

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Бём, А. , Кайзер, М., Ли, Х., Спенглер, К., Каспер, С.А., Акерманн, М., и соавт. (2010). Опосредованная вторым мессенджером регулировка скорости плавания бактерий. Сотовый 141, 107–116. doi: 10.1016/j.моб.2010.01.018

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Бруни, Г., Уикли, А., Додд, Б., и Краль, Дж. (2017). Потенциалзависимый поток кальция опосредует механоощущение Escherichia coli . Проц. Натл. акад. науч. США . 114, 9445–9450. doi: 10.1073/pnas.1703084114

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Чао, Дж., Сонг, К., Ван, Х., Ли, З., Чжан, Ю., Инь, С., и др. (2017). Колориметрический и флуоресцентный pH-зонд для визуализации в E.coli клетки. RSC Adv . 7, 964–970. дои: 10.1039/C6RA24885C

Полнотекстовая перекрестная ссылка | Академия Google

Чимерель, К., Филд, К.М., Пинеро-Фернандес, С., Кейзер, У.Ф., и Саммерс, Д.К. (2012). Индол предотвращает деление клеток Escherichia coli , модулируя мембранный потенциал. Биохим. Биофиз. Acta 1818, 1590–1594. doi: 10.1016/j.bbamem.2012.02.022

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Деме, Дж.C., Johnson, S., Vickery, O., Muellbauer, A., Monkhouse, A., Griffiths, T., et al. (2020). Структура статорного комплекса, управляющего вращением бактериального жгутика. Нац. Микробиол . 5, 553–1564. doi: 10.1038/s41564-020-0788-8

Полнотекстовая перекрестная ссылка | Академия Google

Фанг, X., и Гомельский, М. (2010). Посттрансляционный c-di-GMP-зависимый механизм, регулирующий подвижность жгутиков. Мол. Микробиол . 76, 1295–1305. doi: 10.1111/j.1365-2958.2010.07179.x

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Фукуока Х., Вада Т., Кодзима С., Исидзима А. и Хомма М. (2009). Натрий-зависимая динамическая сборка мембранных комплексов в жгутиковых моторах, управляемых натрием. Мол. Микробиол . 71, 825–835. doi: 10.1111/j.1365-2958. 2008.06569.x

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Гэйбл, К.В., и Берг, Х.К. (2003). Скорость жгутикового роторного двигателя Escherichia coli изменяется линейно с протондвижущей силой. Проц. Натл. акад. науч. США . 100, 8748–8751. doi: 10.1073/pnas.1533395100

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Хан, Дж., и Берджесс, К. (2010). Флуоресцентные индикаторы внутриклеточного рН. Хим. Версия . 110, 2709–2728. дои: 10.1021/cr9z

Полнотекстовая перекрестная ссылка | Академия Google

Humphries, J., Xiong, L., Liu, J., Prindle, A., Yuan, F., Arjes, H.A., et al. (2017). Независимое от вида притяжение к биопленкам посредством передачи электрических сигналов. Ячейка 168, 200–209.e12. doi: 10.1016/j.cell.2016.12.014

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Имадзава Р., Такахаши Ю., Аоки В., Сано М. и Ито М. (2016). Бактериальный жгутиковый двигатель нового типа, который может использовать двухвалентные катионы в качестве связующего иона. Науч. Реп . 6:19773. дои: 10.1038/srep19773

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Исида Т., Кларк Дж., Мацке Н. Дж., Сова Ю. и Бейкер М.А.Б. (2019). Статоры бактериального жгутикового двигателя, питаемые натрием, могут генерировать крутящий момент в присутствии фенамила с мутациями вблизи области связывания пептидогликана. Мол. Микробиол . 111, 1689–1699. doi: 10.1111/mmi.14246

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ислам, М.И., Лин, А., Лай, Ю.-В., Мацке, Н.-Дж., и Бейкер, М.А.Б. (2020). Реконструкции наследственной последовательности MotB являются протон-подвижными и требуют MotA для подвижности. Перед.Миркробиол . 11:3271. doi: 10.3389/fmicb.2020.625837

Полнотекстовая перекрестная ссылка | Академия Google

Ито, М. , Терахара, Н., Фудзинами, С., и Крулвич, Т. А. (2005). Свойства подвижности у Bacillus subtilis , питаемого жгутиковым статором MotAB, соединенным H + , MotPS, соединенным Na + , или гибридными статорами MotAS или MotPB. Дж. Мол. Биол . 352, 396–408. doi: 10.1016/j.jmb.2005.07.030

Полнотекстовая перекрестная ссылка | Академия Google

Кавагиши И., Maekawa, Y., Atsumi, T., Homma, M., and Imae, Y. (1995). Выделение мутантов с дефектом полярного и латерального жгутика в Vibrio alginolyticus и идентификация их жгутиковых источников энергии. Дж. Бактериол . 177, 5158–5160. doi: 10.1128/JB.177.17.5158-5160.1995

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Хан С., Дапис М. и Хумаюн И. (1990). Трансдукция энергии в бактериальном жгутиковом моторе. Влияние нагрузки и рН. Биофиз. Дж . 57, 779–796. doi: 10.1016/S0006-3495(90)82598-4

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Хан С. , Мейстер М. и Берг Х.К. (1985). Ограничения вращения жгутиков. Дж. Мол. Биол . 184, 645–656. дои: 10.1016/0022-2836(85)-9

Полнотекстовая перекрестная ссылка | Академия Google

Краль, Дж. М., Хохбаум, Д. Р., Дуглас, А. Д., и Коэн, А. Э. (2011). Электрические пики в Escherichia coli , зондированные с помощью флуоресцентного белка, указывающего напряжение. Наука 333, 345–348. doi: 10.1126/science.1204763

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Краснопеева, Э., Ло, С.-Дж., и Пилизота, Т. (2019). Электрофизиология одноклеточных бактерий выявляет механизмы стресс-индуцированного повреждения. Биофиз. Дж . 116, 2390–2399. doi: 10.1016/j.bpj.2019.04.039

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Курре Р., Кузель Н., Рамакришнан К. и Олдевуртель Э.Р. (2013). Скорость переключения поверхностной подвижности гонококков коррелирует с движущей силой протонов. PLoS ONE 8:e67718. doi: 10.1371/journal.pone.0067718

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ларкин, Дж. В., Чжай, X., Кикучи, К., Редфорд, С. Е., Приндл, А., Лю, Дж., и соавт. (2018). Проникновение сигнала в бактериальном сообществе. Сотовая система . 7, 137–145. doi: 10.1016/j.cels.2018.06.005

Полнотекстовая перекрестная ссылка | Академия Google

Ларсен, С.Х., Адлер Дж., Гаргус Дж.Дж. и Хогг Р.В. (1974). Химиомеханическое соединение без АТФ: источник энергии для подвижности и хемотаксиса у бактерий. Проц. Натл. акад. науч. США . 71, 1239–1243. doi: 10.1073/pnas.71.4.1239

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Leake, M.C., Chandler, J.H., Wadhams, G.H., Bai, F., Berry, R.M., and Armitage, J.P. (2006). Стехиометрия и оборот в отдельных функционирующих мембранных белковых комплексах. Природа 443, 355–358. doi: 10.1038/nature05135

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Леле, П. П., Хосу, Б. Г., и Берг, Х. К. (2013). Динамика механоощущения в бактериальном жгутиковом моторе. Проц. Натл. акад. науч. США . 110, 11839–11844. doi: 10.1073/pnas.1305885110

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Лю, Дж., Мартинес-Коррал, Р., Приндл, А., Ли, Д.-Ю. Д., Ларкин Дж., Габалда-Сагарра, М., и др. (2017). Связь между удаленными биопленками и появление разделения времени питательных веществ. Наука 356, 638–642. doi: 10.1126/science.aah5204

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Лю Дж., Приндл А., Хамфрис Дж., Габалда-Сагарра М., Асаллы М., Ли Д.-Ю. Д. и др. (2015). Метаболическая взаимозависимость вызывает коллективные колебания внутри биопленок. Природа 523, 550–554. doi: 10.1038/nature14660

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ло, К.Дж., Лик, М.К., и Берри, Р.М. (2006). Флуоресцентное измерение внутриклеточной концентрации натрия в отдельных клетках Escherichia coli . Биофиз. Дж . 90, 357–365. doi: 10.1529/biophysj.105.071332

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ло, С.Дж., Лик, М.С., Пилизота, Т., и Берри, Р.М. (2007). Неэквивалентность мембранного напряжения и ионного градиента как движущих сил бактериального жгутикового мотора при низкой нагрузке. Биофиз.Дж . 93, 294–302. doi: 10.1529/biophysj.106.095265

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Мадейра, Ф., Парк, Ю.М., Ли, Дж., Бусо, Н., Гур, Т., Мадхусуданан, Н., и др. (2019). API инструментов поиска и анализа последовательности EMBL-EBI в 2019 г. Nucleic Acids Res . 47, W636–W641. doi: 10.1093/нар/gkz268

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Малони, П., Кашкет, Э., и Гастингс Уилсон, Т. (1974).Протонная движущая сила управляет синтезом АТФ в бактериях. Проц. Натл. акад. науч. США . 71, 3896–3900. doi: 10.1073/pnas. 71.10.3896

Полнотекстовая перекрестная ссылка | Академия Google

Mancini, L., Terradot, G., Tian, ​​T., Pu, Y., Li, Y., Lo, C.-J., et al. (2020). Общий рабочий процесс для характеристики нернстовских красителей и их влияния на физиологию бактерий. Биофиз. Дж . 118, 4–14. doi: 10.1016/j.bpj.2019.10.030

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Мэнсон, М.Д., Тедеско П., Берг Х.К., Гарольд Ф.М. и Ван дер Дрифт К. (1977). Протондвижущая сила приводит в движение жгутики бактерий. Проц. Натл. акад. науч. США . 74, 3060–3064. doi: 10.1073/pnas.74.7.3060

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Мэнсон, доктор медицины, Тедеско, П.М., и Берг, Х.К. (1980). Энергетика вращения жгутиков у бактерий. Дж. Мол. Биол . 138, 541–561. doi: 10.1016/S0022-2836(80)80017-9

Полнотекстовая перекрестная ссылка | Академия Google

Мартинак, Б., Саими, Ю. , и Кунг, К. (2008). Ионные каналы в микробах. Физиол. Версия . 88, 1449–1490. doi: 10.1152/physrev.00005.2008

Полнотекстовая перекрестная ссылка | Академия Google

Martinez, K.A., Kitko, R.D., Mershon, J.P., Adcox, H.E., Malek, K.A., Berkmen, M.B., et al. (2012). Реакция рН цитоплазмы на кислотный стресс в отдельных клетках Escherichia coli и Bacillus subtilis , наблюдаемая с помощью микроскопии с визуализацией отношения флуоресценции. Заяв. Окружающая среда.Микробиол . 78, 3706–3714. doi: 10.1128/AEM.00354-12

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Masi, E., Ciszak, M., Santopolo, L., Frascella, A., Giovennetti, L., Marchi, E., et al. (2015). Электрические выбросы в бактериальных биопленках. J. R. Soc. Интерфейс 12:20141036. doi: 10.1098/rsif.2014.1036

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Маккартер, Л., Хилмен, М., и Сильверман, М. (1988). Жгутиковый динамометр контролирует дифференцировку роевых клеток V.парагемолитический. Сотовый 54, 345–351. дои: 10.1016/0092-8674(88)-3

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Miesenböck, G., De Angelis, D.A., and Rothman, J.E. (1998). Визуализация секреции и синаптической передачи с помощью рН-чувствительных зеленых флуоресцентных белков. Природа 394, 192–195. дои: 10.1038/28190

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Минамино Т., Имаэ Ю., Осава Ф., Кобаяши Ю.и Осава, К. (2003). Влияние внутриклеточного pH на скорость вращения бактериальных жгутиковых двигателей. Дж. Бактериол . 185, 1190–1194. doi: 10.1128/JB.185.4.1190-1194.2003

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Минамино Т., Моримото Ю. В., Хара Н., Олдридж П. Д. и Намба К. (2016). Бактериальный жгутиковый комплекс экспортных ворот типа III представляет собой двухтопливный двигатель, который может использовать как H + , так и Na + для экспорта жгутикового белка. ПЛОС Патог . 12:e1005495. doi: 10.1371/journal.ppat.1005495 ​​

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Моримото В.Ю., Накамура С., Ками-икэ Н., Намба К. и Минамино Т. (2010). Заряженные остатки в цитоплазматической петле MotA необходимы для сборки статора в бактериальный жгутиковый двигатель. Мол. Микробиол . 78, 1117–1129. doi: 10.1111/j.1365-2958.2010.07391.x

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Моримото, Ю.В., Ками-икэ Н., Мията Т., Кавамото А., Като Т., Намба К. и др. (2016). Визуализация рН с высоким разрешением живых бактериальных клеток для обнаружения локальных различий рН. mBio 7, e01911–16. doi: 10.1128/mBio.01911-16

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Нишихара Ю. и Китао А. (2015). Диффузия протонов, контролируемая воротами, и храповое движение, вызванное протонированием, в статоре бактериального жгутикового двигателя. Проц. Натл. акад. науч. У.SA . 112, 7737–7742. doi: 10.1073/pnas.15029

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Nord, A.L., Gachon, E., Perez-Carrasco, R., Nirody, J.A., Barducci, A., Berry, R.M., et al. (2017). Улавливающая связь управляет механочувствительностью статора в бактериальном жгутиковом моторе. Проц. Натл. акад. науч. США . 114, 12952–12957. doi: 10.1073/pnas.1716002114

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Оноэ, С., Йошида, М., Терахара, Н., и Сова, Ю. (2020). Специфичность связывания ионов жгутиковых статорных белков MotA1/MotB1 Paenibacillus sp. ТСА20. Биомолекулы 10:1078. doi: 10.3390/biom10071078

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Пол, К., Нието, В., Карлквист, В. К., Блэр, Д. Ф., и Харши, Р. М. (2010). c-di-GMP связывающий белок YcgR контролирует направление жгутиковой моторики и скорость, чтобы воздействовать на хемотаксис с помощью механизма «обратного тормоза». Мол. Ячейка 38, 128–139. doi: 10.1016/j.molcel.2010.03.001

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Paulick, A., Delalez, N.J., Brenzinger, S., Steel, B.C., Berry, R.M., Armitage, J.P., et al. (2015). Динамика двойного статора в жгутиковом двигателе Shewanella oneidensis MR-1. Мол. Микробиол . 96, 993–1001. doi: 10.1111/mmi.12984

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Паулик, А., Koerdt, A., Lassak, J., Huntley, S., Wilms, I., Narberhaus, F., et al. (2009). Две разные системы статоров приводят в движение один полярный жгутик у Shewanella oneidensis MR-1. Мол. Микробиол . 71, 836–850. doi: 10.1111/j.1365-2958.2008.06570.x

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Приндл, А., Лю, Дж., Асалли, М., Ли, С., Гарсия-Охальво, Дж., и Сюэль, Г. М. (2015). Ионные каналы обеспечивают электрическую связь в бактериальных сообществах. Природа 527, 59–63. doi: 10.1038/nature15709

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Расмуссен, М.Б., Оддершеде, Л.Б., и Зигумфельдт, Х. (2008). Оптический пинцет вызывает физиологическое повреждение бактерий Escherichia coli и листерий. Заяв. Окружающая среда. Микробиол . 74, 2441–2446. doi: 10.1128/AEM.02265-07

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Россманн, Ф. М., и Биби, М.(2018). Взгляд на эволюцию жгутиковых двигателей бактерий из высокопроизводительной электронной криотомографии in situ и усреднения субтомограммы. Acta Кристаллогр. Разд. Д 74, 585–594. дои: 10.1107/S2059798318007945

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Рупрехт, К., Винген, М., Поцкей, Дж., Генш, Т., Ягер, К.-Э., и Дреппер, Т. (2017). Новый набор биосенсорных инструментов на основе FbFP для чувствительного определения внутриклеточного рН in vivo . Дж. Биотехнология . 258, 25–32. doi: 10.1016/j.jbiotec.2017.05.006

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Сантивери, М., Роа-Эгиара, А., Куне, К., Вадхва, Н., Ху, Х., Берг, Х.С., и соавт. (2020). Структура и функция статорных единиц бактериального жгутикового мотора. сотовый 183, 1–14. doi: 10.1016/j.cell.2020.08.016

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Шиои Дж. И., Мацуура С. и Имаэ Ю.(1980). Количественные измерения протонной движущей силы и подвижности в Bacillus subtilis. Дж. Бактериол . 144, 891–897. doi: 10.1128/JB.144.3.891-897.1980

Полнотекстовая перекрестная ссылка | Академия Google

Siegumfeldt, H., Rechinger, B., and Jakobsen, M. (2000). Динамические изменения внутриклеточного рН в отдельных клетках молочнокислых бактерий в ответ на быстрое падение внеклеточного рН. Заяв. Окружающая среда. Микробиол . 66, 2330–2335. doi: 10. 1128/AEM.66.6.2330-2335.2000

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Сирек, Т., Бенаррох, Дж. М., Буффард, П., Гарсия-Охалво, Дж., и Асалли, М. (2019). Электрическая поляризация обеспечивает интегративный контроль качества во время дифференцировки бактерий в споры. iScience 16, 378–389. doi: 10.1016/j.isci.2019.05.044

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Сова, Ю., и Берри, Р.М. (2008). Бактериальный жгутиковый двигатель. В.Ред. Биофиз . 41, 103–132. дои: 10.1017/S0033583508004691

Полнотекстовая перекрестная ссылка | Академия Google

Сова, Ю., Хомма, М., Исидзима, А., и Берри, Р. М. (2014). Бактериальные жгутиковые моторы на гибридном топливе у Escherichia coli. проц. Натл. акад. науч. США . 111, 3436–3441. doi: 10.1073/pnas.1317741111

Полнотекстовая перекрестная ссылка | Академия Google

Сова, Ю., Хотта, Х., Хомма, М., и Исидзима, А. (2003). Взаимосвязь крутящий момент-скорость жгутикового мотора Na + Vibrio alginolyticus.Дж. Мол. Биол . 327, 1043–1051. doi: 10.1016/S0022-2836(03)00176-1

Полнотекстовая перекрестная ссылка | Академия Google

Сова, Ю., Роу, А.Д., Лик, М.С., Якуши, Т., Хомма, М., Исидзима, А., и другие. (2005). Непосредственное наблюдение за шагами вращения бактериального жгутикового мотора. Природа 437, 916–919. doi: 10.1038/nature04003

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Stratford, J.P., Edwards, C.L.A., Ghanshyam, M.J., Малышев Д., Делиз М.А., Хаяши Ю. и соавт. (2019). Электрически индуцированная динамика бактериального мембранного потенциала соответствует способности клеточной пролиферации. Проц. Натл. акад. науч. США . 116, 9552–9557. doi: 10.1073/pnas.1

8116

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Судзуки Ю., Моримото Ю.В., Ооно К. , Хаяши Ф., Осава К., Кудо С. и др. (2019). Влияние мутации MotA(M206I) на генерацию крутящего момента и сборку статора в жгутиковом двигателе, управляемом Salmonella H + . Дж. Бактериол . 201:e00727-18. doi: 10.1128/JB.00727-18

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Терахара Н., Кодера Н., Учихаши Т., Андо Т., Намба К. и Минамино Т. (2017). Na-индуцированный структурный переход MotPS для сборки статора жгутикового двигателя. Науч. Дополнение . 3:4119. doi: 10.1126/sciadv.aao4119

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Терахара, Н., Крулвич, Т. А.и Ито, М. (2008). Мутации изменяют использование натрия по сравнению с протоном жгутиковым мотором Bacillus clausii и придают двойное использование ионов субтилисмоторам Bacillus. проц. Натл. акад. науч. США . 105, 14359–14364. doi: 10.1073/pnas.0802106105

Полнотекстовая перекрестная ссылка | Академия Google

Терахара Н. , Сано М. и Ито М. (2012). Жгутиковый двигатель Bacillus, который может использовать как Na + , так и K + в качестве связывающего иона, преобразуется в результате одной мутации для использования только Na + . PLoS ONE 7:e46248. doi: 10.1371/journal.pone.0046248

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Терашима Х., Ли Н., Сакума М., Койке М., Кодзима С., Хомма М. и др. (2013). Взгляд на механизм сборки супрамолекулярных колец натриевого жгутикового мотора Vibrio из структуры FlgT. Проц. Натл. акад. науч. США . 110, 6133–6138. doi: 10.1073/pnas.1222655110

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Торманн, К.М. и Паулик А. (2010). Настройка жгутикового мотора. Микробиология 156 (часть 5), 1275–1283. doi: 10.1099/мик.0.029595-0

Полнотекстовая перекрестная ссылка | Академия Google

Типпинг, Дж. М., Стил, С. Б., Делалез, Дж. Н., Берри, М. Р., и Армитаж, П. Дж. (2013). Количественная оценка динамики статора жгутикового двигателя с помощью in vivo контроля протонно-движущей силы. Мол. Микробиол . 87, 338–347. doi: 10.1111/mmi.12098

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Типпинг, М.Дж., Делалез, Нью-Джерси, Лим, Р., Берри, Р.М., и Армитаж, Дж.П. (2013). Зависимая от нагрузки сборка бактериального жгутикового мотора. mBio 4, e00551–13. doi: 10.1128/mBio.00551-13

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Уолтер, Дж. М., Гринфилд, Д., Бустаманте, К., и Липхардт, Дж. (2007). Светоактивная Escherichia coli с протеородопсином. Проц. Натл. акад. науч. США . 104, 2408–2412. doi: 10.1073/pnas.0611035104

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Чжоу, Дж., Sharp, L.L., Tang, H.L., Lloyd, S.A., Billings, S., Braun, T.F., et al. (1998). Функция протонируемых остатков в жгутиковом моторе Escherichia coli : критическая роль для ASP 32 MotB. Дж. Бактериол . 180, 2729–2735. doi: 10.1128/JB.180.10.2729-2735.1998

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Гликолиз играет важную роль в добавлении аденозинтрифосфата в жгутиковое движение сперматозоидов мышей | Биология репродукции

Аннотация

Сперматозоиды млекопитающих должны быть очень подвижными в течение длительного времени, чтобы оплодотворить яйцеклетку.Предполагалось, что АТФ, необходимая для жгутикового движения сперматозоидов, зависит преимущественно от митохондриального дыхания. Мы оценили вклад митохондриального дыхания в подвижность сперматозоидов мыши. Сперматозоиды мышей сохраняли энергичную подвижность с высокой частотой сокращений в соответствующем растворе, содержащем такой субстрат, как глюкоза. Активная сперма содержала большое количество АТФ. Когда для подавления окислительного фосфорилирования в митохондриях применяли карбонилцианид-м-хлорфенилгидразон (CCCP), энергичная подвижность сохранялась, а количество АТФ поддерживалось на уровне, эквивалентном таковому без CCCP.Когда вместо глюкозы вводили пируват или лактат, подвижность сперматозоидов и количество АТФ были высокими. Однако они резко снижались при подавлении окислительного фосфорилирования добавлением CCCP. Мы также обнаружили, что подвижность сперматозоидов не может поддерживаться в присутствии респираторных субстратов, когда гликолиз подавляется. 2-дезокси-d-глюкоза (DOG) не влияла на митохондриальное дыхание, оцененное с помощью флуоресцентного зонда, 5,5′,6,6′-тетрахлор-1,1′,3,3′-тетраэтилбензимидазолилкарбоцианин йодид (JC-1 ), но он ингибировал подвижность и снижал содержание АТФ, когда в качестве субстратов использовались пируват или лактат.Настоящие результаты предполагают, что гликолиз играет неожиданно важную роль в обеспечении АТФ, необходимой для подвижности сперматозоидов, по всей длине жгутика сперматозоидов.

Введение

Большинство тестикулярных сперматозоидов млекопитающих изначально неактивны и созревают в эпидидимальной жидкости [1]. Сперматозоиды в хвостовом придатке активируются для движения при эякуляции, где они смешиваются с секретом добавочных желез. Активированные сперматозоиды еще не могут оплодотворить яйцеклетку без капацитации, при которой подвижность экстенсивно меняется на гиперактивацию [1].Для активации и гиперактивации подвижности необходимы некоторые внеклеточные факторы и различные внутриклеточные реакции, такие как фосфорилирование белков [1-4]. Сперматозоиды должны быть высокоподвижными во время активации и гиперактивации в течение длительного времени, а именно, для гиперактивации сперматозоидов мышей требуется более 1 ч in vivo [5] и 3 ч in vitro [6]. В течение этих длительных периодов сперматозоиды нуждаются в производстве АТФ для движения жгутиков и передачи сигнала посредством фосфорилирования белков.

Существует два пути образования АТФ в сперме млекопитающих: гликолиз и митохондриальное дыхание.У некоторых млекопитающих гликолизируемые субстраты присутствуют в семенной жидкости (человек [7], бык [8], морская свинка [9]) и репродуктивной жидкости самок (свинья [10], овца [11], крупный рогатый скот [12], мышь [9]. 13]), а ферментативная активность гликолиза выявляется в сперме млекопитающих [14, 15]. Ферменты, связанные с гликолизом, локализуются в хвосте спермы хряка и мыши [16–19]. Кроме того, в нескольких исследованиях была документально подтверждена взаимосвязь между гликолизом и зависимой от капацитации передачей сигналов в клетках [4]. Было также показано, что гликолизируемый субстрат играет существенную роль в капацитации сперматозоидов [20, 21] и проникновении в блестящую оболочку [22–24].Эти сообщения предполагают, что глюкоза и/или гликолиз являются одним из факторов, участвующих в передаче сигнала через фосфорилирование тирозина.

Хотя важность гликолиза для фосфорилирования белков и оплодотворения получила признание в последние годы, это не было замечено в вопросе выработки энергии для движения жгутиков. В настоящем исследовании мы сосредоточились на взаимосвязи между движением жгутиков и энергетическим метаболизмом после активации. Движение жгутика является продуктом активности динеин-АТФазы, локализованной по всей длине жгутика и зависящей от поступления АТФ.Семенная жидкость и женская репродуктивная жидкость у млекопитающих содержат метаболические субстраты, такие как фруктоза и глюкоза [8]. Поэтому обычно предполагается, что АТФ, субстрат динеина, поступает за счет гликолиза и дыхания, которые метаболизируют эти внеклеточные субстраты. Поскольку дыхание в митохондриях превосходит гликолиз по эффективности синтеза АТФ, широко предполагалось, что в нормальных условиях АТФ, необходимый для подвижности сперматозоидов, вырабатывается митохондриальным дыханием.

Поскольку жгутик сперматозоидов очень длинный и тонкий (длина сперматозоидов мыши составляет около 150 мкм), диффузии может быть недостаточно для транспорта АТФ к кончику хвоста со скоростью, необходимой для подвижности сперматозоидов [25]. Чтобы преодолеть трудности, Tombes и Shapiro предположили, что фосфорилкреатиновый (PCr) челнок, предложенный в мышцах, опосредует транспорт энергии в сперме [26]. В сперме морского ежа обнаружены ферменты, ассоциированные с челноком ПКр [27]. Таким образом, PCr-шаттл может успешно функционировать как система транспортировки энергии от митохондрий к кончику хвоста морского ежа.С другой стороны, ферменты, связанные с челночной системой PCr, отсутствуют в сперме хряков и быков [28] и, вероятно, имеют низкую активность у других видов млекопитающих [29], включая сперму мышей [30]. Если это так, то необходим другой механизм, обеспечивающий поставку АТФ по всей длине хвоста спермия.

В этой статье мы демонстрируем, что гликолиз очень важен для подвижности сперматозоидов мыши. Мы раскрываем ранее не подозревавшуюся роль гликолиза в энергетическом метаболизме сперматозоидов, которая может решить проблему снабжения АТФ по всей длине хвоста сперматозоида млекопитающих.

Материалы и методы

Подготовка спермы и среды

Сперму получали из придатка яичка самцов мышей ICR в возрасте от 10 до 14 недель (от Nihon SLC, Сидзуока, Япония) в соответствии с рекомендациями Токийского университета. Придаток удаляли, а сухую сперму осторожно выдавливали пинцетом. Для наблюдения до и после начала активации спермы сухую сперму сначала разводили в 100 мкл раствора сахарозы (300 мМ сахарозы, 10 мМ Hepes-NaOH, pH 7.4), в котором сперматозоиды проявляли очень низкую активность (около 1 Гц частоты биений), которую Fujinoki et al. назвал инициированной спермой. [31]. Суспензию спермы разбавляли тестируемым раствором для следующих экспериментов. Тестовый раствор содержал 150 мМ NaCl, 5,5 мМ KCl, 0,4 мМ MgSO 4 , 1 мМ CaCl 2 , 10 мМ NaHCO 3 , 10 мМ Hepes-NaOH, pH 7,4, и метаболические субстраты, такие как глюкоза. Один объем раствора сахарозы, содержащего сперму, разводили в 10 объемах каждого тестируемого раствора, и эту суспензию инкубировали при 37°С для наблюдения.

Для экспериментов по ингибированию сперматозоиды инкубировали в растворе сахарозы, содержащем карбонилцианид м-хлорфенилгидразон (CCCP) или антимицин А, в течение 10 мин с последующим смешиванием с тестируемым раствором, содержащим ингибиторы, для наблюдения. Аналог глюкозы, 2-дезокси-d-глюкоза (DOG), добавлялся к тестируемому раствору вместе с другими метаболическими субстратами.

Образцы спермы высокого качества (подвижность > 70–80%, частота сокращений > 15 Гц), оцененные, как описано ранее [32], использовались для экспериментов в течение 3 ч.

Наблюдение и анализ подвижности сперматозоидов

В настоящих экспериментах мы сосредоточились на параметрах активности движения сперматозоидов, а не на процентной подвижности, потому что сперматозоиды уже были активированы присутствием Ca 2+ и бикарбоната [32]. Мы проанализировали частоту биений и форму волны жгутиков.

После разбавления тестируемым раствором аликвоту (40 мкл) суспензии сперматозоидов помещали на предварительно подогретое предметное стекло и сразу же накрывали покровным стеклом.Мы могли наблюдать два типа подвижных сперматозоидов: один свободно плавал, а другой прикреплял головку к поверхности стекла с помощью движущегося жгутика. Для анализа частоты биений и формы волны прикрепленные сперматозоиды регистрировали с помощью фазово-контрастного микроскопа (Optiphoto; Nikon, Токио, Япония) и видеосистемы (камера CCD; Hitachi, Токио, Япония; VTR; Mitsubishi, Токио, Япония). Япония). Наблюдения и регистрацию проводили при 37°С с помощью теплой пластины, помещенной на столик. Большинство бьющихся придатков яичка сперматозоидов стабильно проявляли аналогичную активность.Мы выбрали не менее 15 прикрепленных к голове сперматозоидов случайным образом в каждом экспериментальном условии для измерения частоты биений. Измерения повторяли три раза, каждое со спермой от разных мышей и усредняли.

Анализы проводились по кадрам видеозаписи. Изображения прикрепленных жгутиков сперматозоидов переносили с видеомонитора на прозрачные пластиковые листы с помощью тонкого маркера. Частоту и амплитуду ударов рассчитывали по периоду, необходимому для одного полного цикла ударов.Форма волны определялась по следам одного полного биения.

Оценка митохондриальной активности

Митохондриальную активность сперматозоидов оценивали путем окрашивания JC-1 (5,5′,6,6′-тетрахлор-1,1′,3,3′-тетраэтилбензимидазолилкарбоцианин йодид). JC-1 распределяли из 1 мМ растворов в ДМСО и разбавляли до 10 мкМ раствором сахарозы, а затем смешивали с одной десятой объема суспензии сперматозоидов. После загрузки в течение 20 мин при комнатной температуре один объем образца разбавляли до 10 объемов испытуемого раствора.Разбавленный раствор спермы переносили в кварцевую кювету и измеряли флуоресценцию JC-1 (возбуждение, 490 нм; эмиссия, 530, 590 нм) с помощью флуоресцентного спектрофотометра (F-4500; Hitachi). Количественные данные отображали с использованием отношения интенсивности флуоресценции (FI) 530 нм к 590 нм. Кроме того, для визуализации сперматозоидов использовалась фазово-контрастная флуоресцентная микроскопия, а изображения записывались на цифровую камеру (Cool Pix 950; Nikon). Регистрировали сперму, прикрепленную к предметному стеклу или покровному стеклу.

Измерение АТФ методом обращенно-фазовой ВЭЖХ

Мы измерили количество АТФ, содержащегося в сперме мыши, с помощью ВЭЖХ с обращенной фазой (серия LC10VP; Shimadzu, Киото, Япония) [33]. Сперматозоиды, взвешенные в тестовом растворе, инкубировали при 37°C в течение 20 мин, быстро смешивали с одной десятой объема охлажденной льдом 3% хлорной кислоты (PCA) для удаления белков и инкубировали еще 10 мин на льду. Раствор центрифугировали и супернатант фильтровали через мембрану 0.Размер пор 22 мкм. Пятьдесят микролитров отфильтрованного супернатанта наносили на колонку ВЭЖХ с обращенной фазой (Phenomenex Luna 5µC18, 4,6 × 150 мм; Shimadzu GLC, Токио, Япония). Элюент готовили из 100 мМ фосфата калия (рН 6,8), 1 мМ гидроксида тетрабутиламмония и 7,5% метанола. В каждой пробе подсчитывали количество сперматозоидов и калибровали содержание АТФ на 10 6 сперматозоидов.

Статистический анализ

Значения частоты сокращений, содержания АТФ и коэффициента интенсивности флуоресценции выражали как среднее значение и стандартное отклонение (SD).Статистические тесты были выполнены с использованием однофакторного дисперсионного анализа с последующим методом наименьших квадратов разности в качестве теста с несколькими диапазонами.

Реагенты

CCCP и антимицин А были приобретены у Sigma Chemical Co. (Сент-Луис, Миссури), JC-1 был приобретен у Molecular Probe (Юджин, Орегон), а другие химикаты имели чистоту реактива у Wako Pure Chemicals Co. Ltd. (Осака, Миссури). Япония).

Результаты

Подвижность сперматозоидов в зависимости от внеклеточных метаболических субстратов

Мы впервые подтвердили поддержку движения жгутиков сперматозоидов экзогенными субстратами. Сперматозоиды придатка хвоста включают зрелый жгутиковый аппарат, так что они демонстрируют частоту биений примерно 20 Гц в тестовом растворе, содержащем кальций и бикарбонат в дополнение к глюкозе (см. Материалы и методы ). Частота биений была выше, чем сообщалось ранее [32], поскольку растворы для предыдущего эксперимента содержали только минимальное количество ингредиентов, таких как сахароза, CaCl 2 и буфер Hepes. Настоящее исследование показало, что биение жгутиков сохранялось в течение всего периода наблюдения, начиная сразу после разведения и заканчивая 30 мин инкубации.

На рис. 1 показаны изменения частоты сокращений (A) и формы волны (B–E) жгутиков с метаболическими субстратами или без них. В отсутствие субстрата частота биений со временем постепенно снижалась, и через 10 мин сперматозоиды уже не проявляли активной подвижности. Через 20 мин частота биений составляла около 1 Гц, а длина волны и амплитуда волн увеличивались, особенно в дистальной части жгутиков (рис. 1Д). С другой стороны, в растворах, содержащих метаболические субстраты, такие как глюкоза, фруктоза, пируват и лактат, сперматозоиды сохраняли активную подвижность как по частоте ударов, так и по форме волны более 30 мин.Пируват и лактат, субстраты для дыхания, могут поддерживать движение в течение более 30 минут, так же как глюкоза и фруктоза. Частота ударов у них достоверно не различалась.

Рис. 1

Изменения частоты биений и формы волны жгутиков сперматозоидов. A ) Изменения частоты биений во времени. Сперму разводили в тестовом растворе в момент времени = 0. Концентрация всех субстратов 5 мМ. Бары представляют SD. N ⩾ 15. Частота биений жгутиков через 5 мин после начала инкубации в растворе без субстрата достоверно отличается от других ( P < 0.01). B E ) Волновая форма жгутиков с различными субстратами через 20 мин после разбавления. B ) Глюкоза, ( C ) лактат, ( D ) пируват и ( E ) не содержат субстрата. Концентрация субстратов 5 мМ. На каждом рисунке наложено несколько линий трасс одного цикла биений. Сперматозоиды показали частоту биений 1 Гц в растворе без субстрата и около 20 Гц в других условиях. Стрелки показывают кончик головки спермия

Рис. 1

Изменения частоты биений и формы волны жгутиков сперматозоидов. A ) Изменения частоты биений во времени. Сперму разводили в тестовом растворе в момент времени = 0. Концентрация всех субстратов 5 мМ. Бары представляют SD. N ⩾ 15. Частота биений жгутиков через 5 мин после начала инкубации в бессубстратном растворе достоверно отличается от остальных ( P < 0,01). B E ) Волновая форма жгутиков с различными субстратами через 20 мин после разбавления. B ) Глюкоза, ( C ) лактат, ( D ) пируват и ( E ) не содержат субстрата.Концентрация субстратов 5 мМ. На каждом рисунке наложено несколько линий трасс одного цикла биений. Сперматозоиды показали частоту биений 1 Гц в растворе без субстрата и около 20 Гц в других условиях. Стрелки показывают кончик головки сперматозоида

Подвижность сперматозоидов можно поддерживать за счет гликолиза

Разобщитель

CCCP [34] использовали для ингибирования продукции митохондриального АТФ. Как показано на рисунке 2А, ​​подвижность сперматозоидов, поддерживаемая субстратами дыхания (пируват или лактат), значительно ингибировалась CCCP.Частота биений уменьшилась до того же уровня, что и в растворе без субстрата (рис. 2А). Однако, когда глюкоза присутствовала в дополнение к CCCP, сперматозоиды сохраняли высокую частоту сокращений (около 20 Гц) в течение более 30 минут (рис. 2B). Форма волны была аналогична наблюдаемой без CCCP (данные не показаны). Подвижность сперматозоидов в присутствии фруктозы была такой же, как и в присутствии глюкозы (данные не представлены). Антимицин А, другой респираторный ингибитор [35], ингибировал подвижность сперматозоидов, как и CCCP (рис. 2, A и B).

Рис. 2

Влияние CCCP и антимицина А на подвижность сперматозоидов в присутствии пирувата ( А ) и глюкозы ( В ). Концентрации субстратов и ингибиторов составляли 5 мМ и 10 мкМ соответственно. A ) Частота биений жгутиков через 5 мин после начала инкубации в растворе пирувата достоверно отличается от других ( P < 0,01). B ) Частота биений жгутиков через 5 мин после начала инкубации в растворе без субстрата достоверно отличается от других ( P < 0.01). Измерение проводилось с использованием тех же образцов спермы, что и на рисунке 1. Столбцы представляют стандартное отклонение. N ⩾ 15

Рис. 2

Влияние CCCP и антимицина А на подвижность сперматозоидов в присутствии пирувата ( А ) и глюкозы ( В ). Концентрации субстратов и ингибиторов составляли 5 мМ и 10 мкМ соответственно. A ) Частота биения жгутиков через 5 мин после начала инкубации в растворе пирувата достоверно отличается от других ( P < 0. 01). B ) Частота биений жгутиков через 5 мин после начала инкубации в растворе без субстрата достоверно отличается от других ( P < 0,01). Измерение проводилось с использованием тех же образцов спермы, что и на рисунке 1. Столбцы представляют стандартное отклонение. N ⩾ 15

Активность митохондрий оценивали по флуоресценции JC-1. Когда мембранный потенциал внутренней митохондриальной мембраны высок, что указывает на активное состояние, JC-1 излучает оранжевый (590 нм) свет, тогда как зеленый (530 нм) свет излучается при низком мембранном потенциале [36].Как показано на рисунке 3А, митохондрии демонстрировали оранжевую эмиссию в присутствии глюкозы, представляющей активное состояние. Добавление CCCP снижало потенциал внутренней мембраны митохондрий как разобщителя (рис. 3B) из-за зеленой эмиссии из митохондрий. Когда в дополнение к CCCP присутствовала глюкоза, митохондрии проявляли зеленую флуоресценцию; однако он показал высокую частоту биений. Кроме того, мы использовали отношения FI (595 нм/535 нм) для митохондриальной активности. Низкий коэффициент FI (0,351, P < 0.05) свидетельствовало о подавлении митохондриальной активности (рис. 3D).

Рис. 3

Митохондриальная активность оценивалась по флуоресценции JC-1. A ) В присутствии глюкозы. Сперматозоиды демонстрируют высокую активность митохондрий. B ) Добавление CCCP к ( A ). Это лечение вызывает низкую активность митохондрий. C ) Добавление DOG к ( A ). Никаких изменений в митохондриальной активности. Левый ряд ( A C ), флуоресцентные изображения в части окрашивания сперматозоидов.Правый ряд, фазово-контрастные изображения. Шкала баров = 20 мкм. D ) Отношение FI (595 нм/535 нм). Соотношение показывает митохондриальную активность. Нет существенных различий между глюкозой, глюкозой с DOG, пируватом и пируватом с DOG. Соотношение глюкозы с CCCP (glu+CC) очень низкое ( P < 0,05)

Рис. 3

Митохондриальная активность оценивается по флуоресценции JC-1. A ) В присутствии глюкозы. Сперматозоиды демонстрируют высокую активность митохондрий. B ) Добавление CCCP к ( A ). Это лечение вызывает низкую активность митохондрий. C ) Добавление DOG к ( A ). Никаких изменений в митохондриальной активности. Левый ряд ( A C ), флуоресцентные изображения в части окрашивания сперматозоидов. Правый ряд, фазово-контрастные изображения. Шкала баров = 20 мкм. D ) Отношение FI (595 нм/535 нм). Соотношение показывает митохондриальную активность. Нет существенных различий между глюкозой, глюкозой с DOG, пируватом и пируватом с DOG.Соотношение глюкозы с CCCP (glu+CC) очень низкое ( P < 0,05)

На следующем этапе количество АТФ непосредственно измеряли с помощью ВЭЖХ. На рис. 4 показано содержание АТФ через 20 мин после инкубации. Было около 200 пмоль АТФ на 10 6 сперматозоидов в отсутствие субстрата и около 1000 пмоль АТФ на 10 6 сперматозоидов в присутствии глюкозы. Даже когда сперму обрабатывали CCCP, в присутствии глюкозы на 10 6 сперматозоидов приходилось около 900 пмоль АТФ.Это количество АТФ было почти эквивалентно уровню, наблюдаемому без CCCP. Когда пируват заменяли глюкозой, количество АТФ также составляло около 900 пмоль на 10 6 сперматозоидов, если не присутствовал CCCP. Однако количество АТФ резко уменьшилось до уровня, наблюдаемого без субстрата, при добавлении CCCP. Этот результат указывает на то, что продукция АТФ из пирувата является результатом митохондриальной активности.

Рис. 4

Влияние ингибитора дыхания CCCP на содержание АТФ в сперме.Данные представляют собой средства трехкратных измерений восьми мышей. Бары представляют SD. Звездочка показывает значительное отличие от другой группы ( P <0,01). CCCP: 10 мкМ. Нижний ряд показывает подвижность сперматозоидов

Рис. 4

Влияние ингибитора дыхания CCCP на содержание АТФ в сперме. Данные представляют собой средства трехкратных измерений восьми мышей. Бары представляют SD. Звездочка показывает значительное отличие от другой группы ( P <0,01). CCCP: 10 мкМ. Нижний ряд показывает подвижность сперматозоидов

Ингибирование гликолиза аналогом глюкозы, DOG

Хотя оказалось, что гликолиза было достаточно для подвижности сперматозоидов, не была исключена возможность того, что гликолиз может быть активирован для компенсации подавления дыхания.Поэтому DOG использовали для ингибирования гликолиза. DOG может проникать в клетку и фосфорилируется до DOG-6-фосфата гексокиназой. Однако DOG-6-фосфат не может подвергаться дальнейшему метаболизму [37, 38]. Было обнаружено, что DOG является конкурентным ингибитором глюкозы в отношении частоты сокращений (рис. 5, A и B). DOG не полностью ингибировал подвижность в присутствии глюкозы, поскольку кажущееся K m для глюкозы (0,027 мМ) было намного меньше, чем K i для DOG (0,027 мМ). 752 мМ). Затем мы более внимательно изучили эффект DOG. Мы подтвердили, что ДОГ не влиял на митохондриальное дыхание с помощью флуоресценции JC-1 (рис. 3). Когда присутствовал DOG и либо глюкоза, либо пируват, митохондрии излучали оранжевый свет, что позволяет предположить, что DOG не влиял на митохондриальную активность (рис. 3C), а соотношения FI пирувата с DOG и глюкозы с DOG существенно не отличались от соотношения глюкозы. или только пируват (рис. 3D).

Рис.5

Влияние DOG на частоту биений жгутиков сперматозоидов. A ) Изменения частоты сокращений при глюкозе. B ) Двойные взаимообратные участки ( A ). Расчет дает 0,025 мМ для кажущегося K m глюкозы и 0,752 мМ для K i DOG

Рис. 5

Влияние DOG на частоту биений жгутиков сперматозоидов. A ) Изменения частоты сокращений при глюкозе. B ) Двойные взаимообратные участки ( A ). Расчет дает 0,025 мМ для кажущейся K m глюкозы и 0,752 мМ для K i DOG

Гликолиз играет важную роль в подвижности сперматозоидов

Хотя DOG не подавлял активность митохондрий, DOG ингибировал подвижность, индуцированную пируватом или лактатом (рис. 6А). На рис. 6В также показано, что подавление подвижности быстро устранялось добавлением глюкозы (до 12 Гц частоты ударов в течение 1 мин), в то время как добавление других субстратов не восстанавливало подвижность.Восстановление, достигаемое глюкозой, зависело от дозы (данные не показаны).

Рис. 6

Влияние DOG на движение жгутиков сперматозоидов, активированное глюкозой или пируватом. Концентрация DOG и других субстратов составляет 2 мМ. A ) Подавление частоты биений DOG. DOG подавлял подвижность, активируемую пируватом, но не подавлял ее в присутствии глюкозы. Через десять минут DOG и DOG с пируватом демонстрируют значительные отличия от глюкозы и глюкозы с DOG ( P < 0. 01). (Столбцы представляют стандартное отклонение, n ⩾ 15.) B ) Влияние DOG и восстановления с глюкозой на форму волны. Слева: форма волны в растворе пирувата и DOG; справа, восстановленная форма волны при добавлении 5 мМ глюкозы

Рис. 6

Влияние DOG на движение жгутиков сперматозоидов, активированное глюкозой или пируватом. Концентрация DOG и других субстратов составляет 2 мМ. A ) Подавление частоты биений DOG. DOG подавлял подвижность, активируемую пируватом, но не подавлял ее в присутствии глюкозы.Через десять минут DOG и DOG с пируватом демонстрируют значительные отличия от глюкозы и глюкозы с DOG ( P <0,01). (Столбцы представляют стандартное отклонение, n ⩾ 15.) B ) Влияние DOG и восстановления с глюкозой на форму волны. Слева: форма волны в растворе пирувата и DOG; справа, восстановленная форма волны при добавлении 5 мМ глюкозы

Когда сперматозоиды, активированные пируватом или лактатом, подвергались воздействию DOG, амплитуда волны и частота биений резко уменьшались (рис. 6B). Жгутики демонстрировали подергивание только в проксимальной области с почти прямой дистальной областью (слева на рис.6Б). Восстановление глюкозой индуцировало большую амплитуду изгиба и полное распространение к дистальному концу. Таким образом, действие DOG обратимо.

Затем мы исследовали содержание АТФ в присутствии DOG. Как показано на рисунке 7, АТФ составлял около 200 пмоль на 10 6 сперматозоидов в растворе пирувата с DOG. Это количество было эквивалентно количеству, измеренному в сперме в растворе без субстрата. Поскольку DOG не ингибирует синтез АТФ в митохондриях, эти наблюдения показывают, что нормального митохондриального дыхания недостаточно для поддержания концентрации АТФ, необходимой для подвижности жгутиков сперматозоидов.

Рис. 7

Концентрация АТФ в сперме. Звездочки представляют значительное отличие от другой группы ( P <0,01). Нижний ряд показывает подвижность сперматозоидов. (Полосы представляют SD; n = 3; каждый образец представляет собой смесь спермы восьми мышей)

Рис. 7

Концентрация АТФ в сперме. Звездочки представляют значительное отличие от другой группы ( P <0,01). Нижний ряд показывает подвижность сперматозоидов. (Полосы представляют SD; n = 3; каждый образец представляет собой смесь сперматозоидов восьми мышей)

Обсуждение

Сперматозоиды мыши должны сохранять высокую подвижность, чтобы достичь яйцеклетки; следовательно, регенерация АТФ очень важна для поддержания подвижности сперматозоидов в течение длительного времени.Имеются сообщения о гликолизе (и/или глюкозе) в сперме [4, 20–24]. Однако в основном они указывали, что глюкоза поддерживает функциональные модификации сперматозоидов, такие как капацитация [39]. В этой статье мы сосредоточились на подвижности и энергии в сперме мышей. Мы обнаружили, что гликолиз играет очень важную роль в подвижности сперматозоидов в дополнение к его ранее предполагаемой роли в поддержании подвижности в анаэробных условиях.

Показано, что частота биений жгутиков пропорциональна скорости гидролиза АТФ динеином при сохранении постоянной формы волны [40].Поэтому мы измерили частоту биений жгутиков как показатель подвижности. Поскольку сперматозоиды мыши вращаются во время свободного плавания [32], мы выбрали сперматозоиды с головками, прикрепленными к поверхности стекла, и записали их на видеопленку для дальнейшего анализа. Хотя частота биений немного ниже у прикрепленных к головке сперматозоидов по сравнению со свободно плавающими, на двойных обратных графиках она демонстрирует ту же линейную зависимость от концентрации АТФ [40].

В растворе без субстрата сперматозоиды активировались с высокой частотой биений, около 20 Гц, и их подвижность быстро снижалась примерно до 1 Гц.В настоящем эксперименте сперматозоиды хвостатого эпидидима были непосредственно разведены в экспериментальном растворе без промывания. Следовательно, остаточная подвижность может быть обусловлена ​​субстратами, оставшимися эндогенно и/или в придатках яичка. Показано, что сперматозоиды длительное время сохраняли подвижность в присутствии такого субстрата, как глюкоза (рис. 1).

Для оценки метаболической активности исследовали количество АТФ и активность митохондрий с помощью флуоресцентного зонда JC-1.Зонд JC-1 давал преимущество в жизненном окрашивании сперматозоидов с сохранением их подвижности. Измерение АТФ показало, что высокая концентрация АТФ, примерно 1000 пмоль/10 6 сперматозоидов, соответствует высокой частоте сокращений при 20 Гц, а низкая концентрация АТФ, 200 пмоль/10 6 сперматозоидов, соответствует низкой частоте сокращений. частота, менее 1 Гц. Частота ударов интактных сперматозоидов, по-видимому, зависит от концентрации АТФ, как это наблюдается в жгутиках демембранированных сперматозоидов [35].

Мы обнаружили значительное количество АТФ в неподвижных сперматозоидах в бессубстратном растворе (рис. 4). Если в основной части жгутиков присутствовало достаточное количество АТФ, сперматозоиды должны двигаться, потому что жгутики в данном эксперименте были функционально активированы присутствием HCO 3 и Ca 2+ [32]. Поэтому можно было бы ожидать, что концентрация АТФ должна быть очень низкой в ​​основной части жгутиков, когда подвижность очень низкая. Однако это должно быть изменено признанием того, что снижение концентрации АТФ будет сопровождаться увеличением концентрации АДФ, которая действует как конкурентный ингибитор подвижности жгутиков [40].Сообщалось, что сперматозоид делится на головку, среднюю часть и основную часть [41]. Таким образом, мы постулировали, что АТФ, обнаруженный в сперматозоидах, взвешенных в растворе без субстрата, был локализован в средней части, где существуют митохондрии, и в головке спермия. Вполне вероятно, что АТФ в средней части и голове остается там и не транспортируется по всему хвосту со скоростью, достаточной для поддержания нормального движения жгутиков. В пользу этой гипотезы свидетельствуют данные о том, что жгутики, ингибированные DOG, проявляли колебания с малой амплитудой в области средней части, которые не распространялись на основную часть.Кроме того, по результатам серии экспериментов с ингибиторами можно было предположить, что способность к синтезу АТФ при дыхании была значительно ниже, чем при гликолизе (рис. 4 и 7).

При наличии глюкозы сперматозоиды демонстрировали высокую частоту сокращений и производили большое количество АТФ. Поэтому можно было предположить, что концентрация АТФ в основном куске была высокой. Как же тогда поступает АТФ в основную часть? Обычно полагают, что АТФ синтезируется в митохондриях путем дыхания и поступает к кончикам жгутиков путем диффузии.Если это так, митохондрии играют важную роль в производстве энергии. Современные эксперименты, однако, свидетельствуют против этой идеи. Даже когда CCCP или антимицин А присутствовали, жгутики демонстрировали высокую частоту сокращений в присутствии глюкозы, в то время как пируват или лактат не могли поддерживать подвижность. Кроме того, эти ингибиторы не могли подавлять синтез АТФ сперматозоидов в присутствии глюкозы, тогда как им удавалось снижать концентрацию АТФ, когда присутствовали только пируват или лактат без глюкозы.Более того, если АТФ синтезируется в митохондриях, то АТФ должен доставляться по всей длине жгутика путем диффузии. Это кажется маловероятным, потому что креатиновый челнок, продемонстрированный в сперме морского ежа [26], не был обнаружен в сперме мыши [30], а жгутики сперматозоидов мыши более чем в три раза длиннее, чем у морских ежей.

Настоящие эксперименты предлагают альтернативное объяснение, указывающее на неожиданно важную роль гликолиза. Сперматозоиды сохраняли как высокую активность биения, так и высокую концентрацию АТФ в присутствии глюкозы, даже когда активность митохондрий подавлялась такими ингибиторами, как CCCP и антимицин А.Эти результаты показали, что АТФ, образующейся в результате гликолиза, было достаточно для движения жгутиков. Более того, сообщалось, что несколько ключевых ферментов гликолиза локализованы в основной части жгутика [16-19]. Поскольку динеин-АТФаза локализуется по всей длине жгутиков для создания активной силы изгиба, кажется вполне логичным, что гликолиз преимущественно обеспечивает АТФ для динеин-АТФазы по всей длине жгутиков. Кроме того, частота биений жгутиков, индуцированная глюкозой, конкурентно ингибировалась DOG (рис. 5). Сообщалось о нескольких наблюдениях, подтверждающих настоящие результаты. Недавно сообщалось, что ферменты, связанные с гликолизом, и переносчики гексоз локализованы в хвосте спермы хряков и мышей [16–19]. Известно, что лактат вырабатывается в подвижной сперме быка [8]. Мы обнаружили лактат, образующийся в присутствии глюкозы в сперме мышей (неопубликованное наблюдение). Кроме того, сообщалось, что семенная плазма богата лактатом, вероятно, из-за подвижных сперматозоидов у некоторых млекопитающих, таких как бык [8], человек [42] и морская свинка [43].Жидкость яйцевода, где сперма встречается с яйцеклеткой для оплодотворения, также содержала большое количество лактата у овец [44] и свиней [45]. Наши результаты показывают, что сперматозоиды могут продуцировать лактат путем гликолиза и потреблять его другим путем, описанным ниже.

Возникает трудность в том, что подвижность сперматозоидов сохраняется длительное время с субстратом для дыхания, пируватом, без глюкозы. Недавно Марин и др. [46] сообщили, что гликолиз играет важную роль в качестве источника энергии в сперме хряка.Они продемонстрировали выработку лактата/пирувата и небольшого количества гликогена. Однако кажется трудным применить эту систему к сперматозоидам мышей, потому что наше наблюдение показало, что пируват может сохранять энергичную подвижность в течение длительного времени так же, как глюкоза в сперме мышей. Затем мы хотели бы представить гипотезу, показанную на рисунке 8. Когда есть внеклеточные субстраты для гликолиза, сперматозоиды метаболизируют эти субстраты путем гликолиза, чтобы обеспечить энергию для движения жгутиков. С другой стороны, когда субстрата для гликолиза мало, сперматозоиды метаболизируют дыхательные субстраты.Мы предполагаем, что эти дыхательные субстраты функционируют как субстраты для глюконеогенеза в средней части, что приводит к глюкозе, которая может диффундировать в другие области жгутика сперматозоидов. Ингибирование DOG движения жгутиков можно объяснить конкуренцией DOG с глюкозой и/или глюкозо-6-фосфатом как продуктами глюконеогенеза [37, 38]. Эта гипотеза должна быть доказана в дальнейших исследованиях. Очень интересно проверить, подходит ли эта модель гликолиза для сперматозоидов других млекопитающих.

Рис. 8

Схематическое представление энергетического метаболизма в сперме мыши. Предполагается, что подвижность сперматозоидов поддерживается АТФ, синтезируемым путем гликолиза. Гликолиз происходит по всей длине основной части жгутика

Рис. 8

Схематическое изображение энергетического обмена в сперме мыши. Предполагается, что подвижность сперматозоидов поддерживается АТФ, синтезируемым путем гликолиза. Гликолиз происходит по всей длине основной части жгутика

Наши результаты показывают, что подвижность сперматозоидов не может поддерживаться в присутствии респираторных субстратов, если гликолиз не функционирует.Таким образом, гликолиз должен играть основную роль в обеспечении АТФ для подвижности сперматозоидов, которая может быть, по крайней мере, столь же важной, как производство субстратов для дыхания или поддержка подвижности в анаэробных условиях. Сперматозоиды должны сохранять подвижность, чтобы достичь ооцита в женских половых путях. Хотя митохондриальное дыхание очень эффективно для использования субстратов для производства АТФ, в отсутствие фосфокреатинового челнока гликолиз должен играть главную роль в обеспечении энергией всего хвоста сперматозоидов мышей.

Благодарности

Мы благодарим доктора. Susan Suarez и Charles Brokaw за критическое прочтение этой рукописи и полезные советы.

Каталожные номера

1.

Янагимати

Р

. Оплодотворение млекопитающих. В:

Knobil

E

,

Neill

JD

(ред.),

The Physiology of Reproduction

, 2nd ed.

Нью-Йорк

:

Raven Press;

1994

:

189

317

2.

Фудзиноки

М

,

Охтаке

Х

,

Окуно

М

.

Фосфорилирование и дефосфорилирование тирозина, связанные с подвижностью сперматозоидов хомяков

.

BIOMED RES

2001

22

:

147

155

3.

155

3.

Si

y

,

okuno

m

.

Роль тирозинового фосфорилирования жгутиковых белков в гиперактивации спермы хомяка

.

Biol Reforod

1999

61

:

240

240

246

4.

Urner

F

,

Sakkas

D

.

Фосфорилирование белков в сперматозоидах млекопитающих

.

Репродукция

2003

125

:

17

26

5.

Остин

CR

. Созревание сперматозоидов в мужских и женских половых путях. В:

Metz

CB

,

Monroy

A

(ред.),

Биология оплодотворения, том. 2, Биология спермы.

Нью-Йорк

:

Academic Press

;

1985

:

121

155

6.

6.

Visconti

PE

,

Bailey

JL

,

Moore

GD

,

PAN

D

,

OLDS-CLARKE

P

,

Копф

ГС

.

Капацитация сперматозоидов мыши. 1. Корреляция между капацитацией и фосфорилированием белка по тирозину

.

Development

1995

121

1129

1129

1137

7.

Povoa

H

,

BASTOS

JJ

,

Silva

Me

,

ARIZA

A

,

Moraes

MIC

,

Родригес

РБ

,

Сильва

MS

.

Глюкоза в сперме человека

.

Биомед Биохим Акта

1986 45 5:

685

686

8.

Манн

Т

,

Лютвак-Манн

С

.

Мужская репродуктивная функция и сперма.

Берлин

:

Springer Verlag;

1981

:

1

34

9.

Frenkel

G

,

Peterson

RN

,

Freund

M

.

Окислительный и гликолитический метаболизм компонентов спермы отмытыми сперматозоидами морских свинок

.

1975

;

26

,

2

:

144

147

 

10.

Nichol

R

,

R

,

Hunter

RHF

,

Gardner

DK

,

Leesce

HJ

,

Cooke

GM

.

Концентрации энергетических субстратов в жидкости яйцевода и плазме крови свиней в периовуляторный период

.

J Reprod Fertil

1992

96

:

699

707

11.

Hamner

CE

. Состав и физиология яйцевода.В:

Greep

RO

,

Astwood

EB

(ред.),

Справочник по физиологии.

Вашингтон, округ Колумбия

:

Американское физиологическое общество;

1973

:

1473

:

141

151

12.

Carlson

D

,

Black

DL

,

Howe

GR

.

Секреция яйцевода коровы

.

J Reprod Fertil

1970

22

:

549

552

13.

Гарднер

ДК

,

Лиз

ХДЖ

.

Концентрации питательных веществ в жидкости яйцеводов мышей и их влияние на развитие эмбриона и метаболизм in vitro

.

J Reford Fertil

1990

88

:

361

361

368

14.

Storey

BT

,

Kayne

FJ

.

Энергетический обмен сперматозоидов. V. Путь гликолиза Эмбдена-Мьергофа: активность ферментов пути в гипотонически обработанных сперматозоидах придатка яичка кролика

.

Fertil Steril

1975

26

:

1257

1257

1265

1265

15.

Ford

WCL

,

REES

JM

. Биоэнергетика подвижности сперматозоидов млекопитающих. В:

Gagnon

C

(ред.),

Контроль подвижности сперматозоидов: биологические и клинические аспекты

.

Бока-Ратон, Флорида

:

CRC Press;

1990

:

175

202

16.

Westhoff

D

,

Камп

G

.

Глицеральдегид-3-фосфатдегидрогеназа связана с фиброзной оболочкой сперматозоидов млекопитающих

.

J Cell SCI

1997

110

:

1821

1829

1829

17.

Travis

AJ

,

Foster

JA

,

Rosenbaum

Na

,

Visconti

PE

,

Гертон

ГЛ

,

Копф

ГС

,

Мосс

СБ

.

Нацеливание специфичной для зародышевых клеток гексокиназы типа 1, не имеющей порин-связывающего домена, на митохондрии, а также на головку и волокнистую оболочку сперматозоидов мышей

.

Мол Биол Селл

1998;

9

:

263

263

263

18.

MORI

C

,

Nakamura

N

,

WELCH

N

JE

,

GOTOH

H

,

Goulding

EH

,

Фудзиока

М

,

Эдди

ЭМ

.

Транскрипты мышиной сперматогенной клетки-специфической гексокиназы типа 1 (mHK-s) экспрессируются путем альтернативного сплайсинга из гена mHK1, а белок HK1-S локализован в основном в хвосте сперматозоида

.

Mol Reford dev

1998

49

:

374

374

385

19.

Angulo

C

,

Rauch

MC

,

DropPlmann

A

,

Reyes

Am

,

SLIBE

JC

,

Delgado-Lopez

F

,

GUAIQUIL

VH

,

VERA

JC

,

CONCHA

II

.

Экспрессия и функция переносчика гексозы в сперматозоидах млекопитающих: клеточная локализация и транспорт гексозы и витамина С

.

J Cell BioChem

1998

71

71

1802

203

20.

Travis

AJ

,

Jorgez

CJ

,

Merdiushev

T

,

Jones

BH

,

DESS

DM

,

DiAZ-CUETO

L

,

L

,

этаж

BT

,

KOPF

GS

,

MOSS

SB

.

Функциональные взаимосвязи между капацитатозависимой передачей сигналов клетками и разделенными метаболическими путями в сперматозоидах мышей

.

J Biol Chem

2001

276

:

7630

7630

7636

7636

7636

7636

7636

7636

21.

Urner

F

,

Leppens-Luisier

G

,

Sakkas

D

.

Фосфорилирование белка тирозина в сперме во время взаимодействия гамет у мыши: влияние глюкозы

.

BIOL REPROD

2001

64

:

1350

1357

1357

22.

Fraser

LR

,

Quinn

PJ

.

Гликолитический продукт необходим для инициации акросомной реакции сперматозоидов и хлыстовой подвижности, необходимых для оплодотворения у мышей

.

J Reprod Fertil

1981

61

:

25

35

23.

Cooper

TG

.

Возникновение и поддержание гиперактивированной подвижности сперматозоидов мыши

.

Gamete RES

1984

9

:

55

74

24.

74

24.

Urner

F

,

Sakkas

D

.

Глюкоза участвует в слиянии сперматозоидов и ооцитов мыши

.

BIOL REPROD

1996

55

:

917

922

922

922

25.

Nevo

AC

,

RikmensPoel

R

.

Диффузия АТФ в жгутиках сперматозоидов

.

J Theor Biol

1970

26

:

11

18

26.

Tombes

RM

,

Shapiro

BM

.

Направление метаболитов: фосфорилкреатиновый челнок для обеспечения транспорта высокоэнергетических фосфатов между митохондриями сперматозоидов и хвостом

.

Cell

1985

41

:

325

325

325

27.

334

27.

Tombes

RM

,

Shapiro

BM

.

Конечные ферменты фосфокреатинового челнока. Очистка и характеристика двух изоферментов креатинкиназы из спермы морского ежа

.

J Biol Chem

1987

282

:

16011

16011

16011

16011

16011

16019

16019

16019

28.

KAMP

G

,

Busselmann

G

,

Lauterwein

J

.

Сперматозоиды: модели для изучения регуляторных аспектов энергетического обмена

.

Experientia

1996

52

487

494

29.

Yeung

CH

,

MUJUMADER

,

GC

,

ROLF

C

,

BeeRe

HM

,

Cooper

TG

.

Роль фосфокреатинкиназы в подвижности сперматозоидов человека, поддерживаемой различными метаболическими субстратами

.

Mol HUM REPROD

1996

2

:

591

596

596

30.

596

30.

STEEHS

K

,

Oerlmans

F

,

Wieringa

B

.

Мыши с дефицитом вездесущей митохондриальной креатинкиназы жизнеспособны и плодовиты

.

Biochim Biophys acta

1995

1230

:

130

138

31.

138

31.

Fujinoki

M

,

Ohtake

H

,

okuno

M

.

Сериновое фосфорилирование жгутиковых белков, связанное с активацией подвижности сперматозоидов хомяка

.

Биомед Рез

2001

22

:

45

58

32.

Si

Y

,

Окуно

M

.

Множественная активация подвижности сперматозоидов мыши

.

Mol Reford dev

1993

36

:

36

:

33.

33.

Samizo

K

,

ISHIKAWA

R

,

NAKAMURA

A

,

KOHAMA

K

.

Высокочувствительный метод измерения активности миозин-АТФазы с помощью высокоэффективной жидкостной хроматографии с обращенной фазой

.

Anal Biochem

2001

293

:

293

:

212

215

34.

215

34.

Guzman-Grenfell

AM

,

Bonilla-Hernandez

MA

,

Gonzalez-Martinez

MT

.

Глюкоза индуцирует Na (+), K (+)-ATPase-зависимую преходящую гиперполяризацию в сперме человека. Индукция изменения потенциала плазматической мембраны протонным ионофором CCCP.

.

Биохим Биофиз Акта

2000

1464

:

188

198

35.

Зенг

Y

,

Кларк

EN

,

Florman

HM

.

Потенциал мембраны сперматозоидов: гиперполяризация во время капацитации регулирует секрецию акросом, зависимую от zona pellucida

.

Dev Biol

1995

171

:

554

554

563

563

563

36.

Garner

DL

,

Thomas

Ca

.

Специфичный для органелл зонд JC-1 идентифицирует различия мембранного потенциала в митохондриальной функции бычьей спермы

.

Mol Reford dev

1999

53

:

222

229

229

37.

Hiipakka

RA

,

Hammerstedt

RH

.

Транспорт 2-дезоксиглюкозы и фосфорилирование бычьей спермой

.

Biol Refrod

1978

1978

19

:

368

379

379

38.

HENE

RV

,

Edwards

KP

.

Влияние 2-дезокси-D-глюкозы и энергетических субстратов на капацитацию сперматозоидов морских свинок и акросомную реакцию

.

J Reford Fertil

1985

73

:

59

69

39.

69

39.

Williams

AC

,

Ford

CL

.

Роль глюкозы в поддержании подвижности и капацитации сперматозоидов человека

.

J Androl

2001

22

:

680

695

695

40.

Okuno

M

,

Brokaw

CJ

.

Ингибирование движения тритон-демембранных жгутиков сперматозоидов морского ежа с помощью Mg2+, ATP4-, ADP и P1

.

J Cell Sci

1979

38

:

105

123

41.

Сравнительный вид ультраструктуры сперматозоидов

.

BIOL REPROD

1970

2

:

2

:

2

:

42.

127

42.

Martikainen

P

,

Sannikka

E

,

Suominen

J

,

Santti

R

.

Содержание глюкозы как показатель качества спермы

.

arch androl

1980

5

:

337

337

337

337

343

43.

Freenkel

G

,

Peterson

RN

,

Freund

M

.

Окислительный и гликолитический метаболизм компонентов спермы отмытыми сперматозоидами морских свинок

.

Fertil Steril

1975

26

:

144

147

147

44.

Restall

BJ

,

Wales

RG

.

Фаллопиевы трубы овцы. Химический состав полей из маточной трубы

.

Aust J Biol Sci

1966;

19

:

687

697

698

45.

Nichol

R

,

R

,

R

,

RH

,

Gardner

DK

,

Leese

HJ

,

Cooke

GM

.

Концентрации энергетических субстратов в жидкости яйцевода и плазме крови свиней в периовуляторный период

.

J REPROD FERTIL

1992

9000

:

699

707

46.

707

46.

,

S

,

Chiang

K

,

Bassilian

S

,

Lee

WN

,

BOROS

LG

,

LG

,

Fernandez-Novell

JM

,

STELLELS

JJ

,

MEDRANO

A

,

RODRIGUEZ-GILL

JE

,

Cascante

M

.

Метаболическая стратегия сперматозоидов хряков, выявленная с помощью метаболической характеристики

.

FEBS Lett

2003

554

:

342

346

© 2004 Общество изучения репродукции, Inc.

Комплексное картирование жгутиковой регуляторной сети Escherichia coli

Образец цитирования: Fitzgerald DM, Bonocora RP, Wade JT (2014) Комплексное картирование Escherichia coli жгутиковой регуляторной сети.PLoS Genet 10(10): е1004649. https://doi. org/10.1371/journal.pgen.1004649

Редактор: Lotte Søgaard-Andersen, Институт наземной микробиологии им. Макса Планка, Германия

Поступила в редакцию: 9 апреля 2014 г.; Принято: 3 августа 2014 г .; Опубликовано: 2 октября 2014 г.

Авторские права: © 2014 Fitzgerald et al. Это статья с открытым доступом, распространяемая в соответствии с лицензией Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания оригинального автора и источника.

Доступность данных: Авторы подтверждают, что все данные, лежащие в основе выводов, полностью доступны без ограничений. Соответствующие данные содержатся в документе и в его файлах вспомогательной информации, за исключением необработанных данных ChIP-seq и RNA-seq, которые предоставляются через общедоступный репозиторий (EBI ArrayExpress). Номера доступа для ArrayExpress: E-MTAB-2457 (данные ChIP-seq) и E-MTAB-2802 (данные RNA-seq).

Финансирование: Эта работа была поддержана Премией нового новатора Национального института здравоохранения (1DP2OD007188 для JTW).Этот материал основан на работе, поддержанной стипендией National Science Foundation Graduate Research Fellowship под номером гранта DGE-1060277 (DMF). DMF также был поддержан грантом на обучение Национального института здравоохранения T32AI055429. Спонсоры не участвовали в разработке исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

Введение

Синтез и подвижность жгутиков бактерий являются строго регулируемыми процессами, включающими положительные и отрицательные входные данные на транскрипционном, посттранскрипционном, трансляционном и посттрансляционном уровнях.Эта сложная регуляторная система позволяет последовательно производить жгутиковые компоненты примерно в том порядке, в котором они требуются для сборки. Один из основных способов установления этой темпоральности — через лежащую в основе иерархическую сеть транскрипции (обзоры [1]–[3]). Промоторы жгутиковых генов делятся на три категории (классы 1, 2 и 3) в зависимости от их времени и способа экспрессии.

[4].Оперон flhDC считается единственной единицей транскрипции класса 1. Экспрессия и активность FlhDC регулируются на нескольких уровнях, что позволяет ему служить интегратором сигналов окружающей среды, питания и фазы роста [5]–[11]. В свою очередь, FlhDC отвечает за активацию транскрипции, прямо или косвенно, всех структурных и регуляторных компонентов жгутикового аппарата.

Промоторы

класса 2 напрямую активируются FlhDC и транскрибируются РНК-полимеразой (РНКП), содержащей первичный σ-фактор, σ 70 [2].Контакты между FlhDC и карбоксиконцевым доменом α-субъединицы РНКП важны для активации, но точный механизм неизвестен [12]. Семь общепринятых FLHDC-зависимых оперонов ( Flgamn , FLGBCDEFGHIJ , FLBAE , Flizy , Fliizy , Flifghijk , Flilefghijk и Flilemnopqr ) кодируют важные регуляторные факторы и структурные компоненты мембраны- охватывая базальное тело и связанный с ним экспортный аппарат [1]. Примечательно, что fliA кодирует альтернативный σ-фактор [13]–[15], а flgM кодирует родственный ему анти-σ-фактор [16]. Взаимодействие между этими двумя факторами регулирует переход от ранней экспрессии жгутиковых генов к экспрессии генов поздней стадии.

Когда в цитоплазме присутствуют и FliA, и FlgM, FlgM связывает FliA, предотвращая взаимодействие с РНКП и подавляя FliA-зависимую транскрипцию. После сборки базального тельца и аппарата секреции (из продуктов гена класса 2) FlgM экспортируется из клетки, высвобождая FliA и позволяя инициировать FliA-зависимую транскрипцию с промоторов класса 3.Это сочетание транскрипции и сборки обеспечивает эффективную кинетику экспрессии «точно вовремя», как это было описано для некоторых метаболических путей [17]. FLIA приводов транскрипции шести обычно принятых оперов класса 3 ( FLGKL , FLGKL , FLGMN , FLGMN , FLGMN , Tar-Tap-Cherbyz ( Meche ) и MOTAB-CHEAW ( Mocha )) и может инициировать транскрипцию собственного оперона, fliAZY . Эти опероны класса 3 кодируют продукты, необходимые для поздней сборки жгутика, такие как субъединицы жгутиковой нити (флагеллин), компоненты мотора и регуляторные факторы, связанные с хемотаксисом.В дополнение к этим классическим оперонам класса 3 было предсказано или показано, что FliA управляет транскрипцией генов, участвующих в хемотаксисе ( trg [18] и tr [19]), аэротаксисе ( aer [18], [20]. ]) и регуляция подвижности циклическим ди-GMP ( yhjH и ycgR [21]). FliA также может управлять транскрипцией оперона fliLMNOPQR класса 2 [22], и предполагается, что FliA-зависимая транскрипция других оперонов класса 2 [1], [2], [23].

В дополнение к их роли в жгутиковой сети транскрипции, FlhDC и FliA вовлечены в регуляцию нежгутиковых генов. В исследованиях сообщается о множестве нежгутиковых генов и процессов, таких как клеточное деление и анаэробный метаболизм, регулируемых FlhDC или только FlhD [24]-[28]. Однако доказательства, предоставленные для большинства этих дополнительных генов-мишеней, такие как изменения в экспрессии генов без информации о связывании ДНК, далеки от окончательных. Сообщения о том, что FlhD действует независимо для регуляции клеточного деления, были прямо опровергнуты другим исследованием [29], и многие предполагаемые мишени FlhDC не были неоднократно обнаружены в нескольких исследованиях [20], [24], [25], [27], [ 28].Кроме того, в большинстве предыдущих исследований не удалось точно разграничить прямую и непрямую регуляцию, зависящую от FlhDC, о чем свидетельствует идентификация связанного с жгутиками гена aer в качестве мишени FlhDC [25], когда он фактически транскрибируется FliA [18]. [20]. Есть несколько хорошо охарактеризованных FliA-зависимых промоторов, таких как modA [30] и flxA [31], которые не имеют очевидной функции в синтезе или подвижности жгутиков. Кроме того, были проведены различные биоинформационные исследования, которые предсказывали FliA-зависимые промоторы на основе идентичности последовательностей, обнаруживая сотни промоторов, многие из которых обладают нежгутиковыми функциями [30], [32], [33]; однако эти предсказания не были проверены экспериментально.

Хотя жгутиковая сеть E. coli широко изучалась за последние несколько десятилетий, многие вопросы еще предстоит решить. К ним относятся (i) способность FlhD оказывать регуляторное действие независимо от FlhC, (ii) степень совместной регуляции FlhDC и FliA и относительный вклад каждого в известные комплексные промоторы, такие как fliAZY и fliLMNOPQR , и (iii) протяженность и состав нежгутиковых регулонов FlhDC и FliA.Иммунопреципитация хроматина с последующим глубоким секвенированием (ChIP-seq) является мощным методом изучения полногеномной локализации ДНК-связывающих белков. ChIP-seq предоставляет информацию с высоким разрешением о месте связывания и относительной аффинности связывания in vivo [34]. Такие факторы, как локальная структура ДНК и связывание нуклеоид-ассоциированных белков и/или других факторов транскрипции, влияют на связывающую и регуляторную активность, что делает прямые измерения in vivo невероятно ценными [35]. RNA-seq представляет собой метод с высоким разрешением для оценки транскриптомных различий между штаммами или состояниями и позволяет идентифицировать новые транскрипты, такие как некодирующие РНК [36]. Комбинируя ChIP-seq и RNA-seq, можно оценить регуляторный эффект каждого сайта связывания и всесторонне установить, какие регуляторные эффекты являются прямыми, а какие косвенными. Комбинация ChIP-seq и анализа транскриптома недавно была применена ко многим бактериальным факторам транскрипции [37]–[39] и σ-факторам [40], [41].Эта мощная комбинация методов в основном использовалась для исследования отдельных ДНК-связывающих белков, но также может быть использована для построения глобальных сетей транскрипции [38]. В этом исследовании мы выполнили ChIP-seq на FlhD, FlhC и FliA и РНК-seq на подвижных производных дикого типа, Δ flhD , Δ flhC и Δ fliA производных E. coli MG1655. . Эти данные показывают новые сайты связывания и регуляторные мишени как для FlhDC, так и для FliA, включая открытие двух FliA-зависимых некодирующих РНК. Мы всесторонне определили прямые и непрямые регулоны этих трех белков и продемонстрировали, что эту информацию можно использовать для построения подробной карты этой иерархической сети транскрипции.

Результаты

Конструирование и проверка штаммов, меченных эпитопом

Для проведения экспериментов с ChIP мы сконструировали штаммы, в которых FlhD, FlhC и FliA были мечены хромосомным эпитопом с помощью метки 3×FLAG. Поскольку оба конца FlhD и FlhC участвуют в комплексообразовании или связывании ДНК [42, 43], мы вставили эпитопные метки во внутренние неструктурированные области (рис. S1A).FliA был помечен на N-конце. Меченые штаммы были сконструированы из малоподвижного производного MG1655, которое не содержало IS-элемента выше flhDC . Спонтанные высокоподвижные изоляты были выделены после инкубации на подвижном агаре, как описано ранее [44]–[46]. Чтобы подтвердить, что все изоляты приобрели подвижность за счет вставки IS-элемента в область выше по течению от flhDC , мы секвенировали вышестоящую и кодирующую области каждого изолята (файл S1). Каждый подвижный изолят имел IS-элемент, встроенный в область перед flhDC , хотя идентичность и расположение IS-элементов различались между штаммами (рис. S1B).Никаких дополнительных мутаций не наблюдалось в flhD , flhC или области между flhD и uspC ни в одном из меченых штаммов. Чтобы гарантировать, что каждая из вставок IS-элемента отвечает за подвижный фенотип штаммов, мы сконструировали штаммы, в которых селектируемый маркерный ген thyA был вставлен в каждое наблюдаемое место вставки. Введение кассеты thyA в каждое из наблюдаемых мест привело к появлению полностью подвижных штаммов (рис. S1C).Этот эксперимент подтвердил, что, хотя меченые штаммы, используемые в этом исследовании, не являются строго изогенными, они, вероятно, функционально эквивалентны. Кроме того, это дает представление о подвижности, связанной с элементами IS, показывая, что приобретение подвижности в значительной степени не зависит от последовательности и местоположения. Это согласуется с предыдущей гипотезой о том, что вставка IS-элемента активирует flhDC путем вытеснения репрессоров, связанных в вышестоящей области [44], [45]. Формально возможно, что меченые штаммы содержат дополнительные мутации, придающие подвижность, но это крайне маловероятно, учитывая частоту выделения подвижных штаммов.

Хотя для каждого меченого штамма были получены подвижные изоляты, все три меченых штамма были менее подвижными, чем аналогично отобранный штамм дикого типа, что позволяет предположить, что мечение эпитопом приводило к умеренному функциональному нарушению (рис. S1D). Возможно, что сниженная функциональность меченых белков может помешать идентификации очень слабых сайтов связывания; однако, как подробно обсуждается ниже, меченые белки приводили к надежному сигналу ChIP-seq во всех широко охарактеризованных сайтах связывания и во многих новых сайтах.Кроме того, сигналы ChIP-seq, генерируемые для белков FlhD-FLAG и FlhC-FLAG, были почти идентичными (рис. 1А), хотя метки вставлены в разные места в четвертичной структуре комплекса FlhD 4 C 2 . Это говорит о том, что каким бы ни был функциональный дефект, он не влияет на способность меченых белков связываться с ДНК. Наконец, эксперименты с RNA-seq (выполненные с изогенным набором штаммов) не подтверждают существование каких-либо непосредственно регулируемых мишеней, не идентифицированных с помощью ChIP-seq.

Рис. 1. Полногеномное связывание FlhD и FlhC.

(A) Полногеномное связывание FlhD (синий) и FlhC (фиолетовый), определенное с помощью ChIP-seq. Серые прямоугольники представляют гены в геноме MG1655. (B) Обогащение ChIP-qPCR в одном хорошо известном ( fliA ) и 5 ​​новых сайтах связывания FlhDC (n = 3). Обогащение ChIP в меченых штаммах сравнивали с немеченым контролем с использованием двухвыборочного Т-критерия: * p <0,05, ** p <0,01 (односторонний). (C) Мотив FlhDC, полученный в этом исследовании с использованием BioProspector [49] (оценка = 1. 49) и визуализируется путем ввода выровненной последовательности в WebLogo [76].

https://doi.org/10.1371/journal.pgen.1004649.g001

Полногеномное связывание FlhD и FlhC

Мы использовали ChIP-seq для оценки полногеномного связывания FlhD и FlhC в E. coli MG1655, выращенных до средней экспоненциальной фазы (OD 600 0,5–0,7) в лизогенном бульоне (LB). Полногеномные профили связывания двух белков показаны на рисунке 1А. На основании строгого анализа пиков было идентифицировано 10 сайтов связывания FlhD и 8 сайтов связывания FlhC (таблица 1).Все 8 сайтов связывания FlhC перекрываются с сайтами связывания FlhD. Два дополнительных сайта связывания FlhD также были связаны со значительной занятостью FlhC, почти не достигая порогового значения в анализе вызова пика. Ни один из пиков, идентифицированных в экспериментах FlhD или FlhC ChIP-seq, не перекрывался с областями, обогащенными в контрольных экспериментах ChIP-seq с использованием немеченых контрольных штаммов. Полная совместная локализация связывания FlhD и FlhC согласуется с тем, что белки связываются только с ДНК в виде гетеромерного комплекса.10 сайтов связывания FlhDC включают все 5 сайтов связывания, связанных с 7 каноническими жгутиковыми оперонами класса 2. Сайт связывания FlhDC был идентифицирован выше yecR , гена с неизвестной функцией, что согласуется с предыдущими сообщениями [20], [24]. Дополнительные 4 идентифицированных сайта связывания представляют собой новые мишени FlhDC. Три новых сайта связывания FlhDC находятся в межгенных областях, выше одного или нескольких генов ( ampH / sbmA , yciK / sohB и gntR ).Оставшийся новый сайт связывания расположен внутри csgC и непосредственно выше сайта начала транскрипции соседнего гена, ymdA [47].

Для подтверждения сайтов связывания FlhDC, идентифицированных с помощью ChIP-seq, для всех локусов была проведена целевая ChIP-qPCR (рис. 1B; таблица S1). Хотя ChIP-qPCR не является полностью независимым методом валидации, он позволяет анализировать большее количество биологических повторов, более прямое сравнение с немечеными контрольными штаммами и уменьшает распространенные артефакты, усиленные амплификацией библиотеки ChIP-seq [48]. В соответствии с выводами ChIP-seq, заполняемость FlhD и FlhC была значительно выше, чем у немеченого штамма (t-критерий, p -значение ≤0,05) для всех локусов. ChIP-qPCR также использовали для оценки занятости FlhDC в ранее предсказанных сайтах связывания [24], не идентифицированных с помощью ChIP-seq (рис. S2). Промотор fliDST был единственным сайтом, который демонстрировал значительную занятость любым белком (рис. 1B, рис. S2). Этот сайт не был идентифицирован нашим анализом вызова пиков ChIP-seq, но небольшие пики правильной формы видны в необработанных данных для обоих белков в этом локусе (см. ниже).Следовательно, мы считаем промотор fliDST подлинным сайтом связывания FlhDC и включили его во все последующие анализы, в результате чего общее количество сайтов связывания FlhDC достигло 11.

Последовательности, окружающие сайты связывания FlhDC, идентифицированные с помощью ChIP-seq и/или ChIP-qPCR, были извлечены и проанализированы с помощью BioProspector [49]. Результирующий мотив, обнаруженный в 7 из 11 сайтов, имеет низкую оценку и является вырожденным (оценка мотива = 1,49, рис. 1C), но хорошо соответствует ранее описанным мотивам для связывания FlhDC [20], [50].

Прямое и косвенное регулирование FlhDC

Чтобы определить влияние идентифицированных сайтов связывания FlhDC на транскриптом, секвенирование РНК было выполнено в подвижном штамме MG1655 дикого типа и изогенных делециях одного гена flhD и flhC . Дифференциальный анализ экспрессии генов был выполнен с использованием Rockhopper, программы анализа РНК-секвенций, оптимизированной для наборов бактериальных данных [36]. Экспрессия генов была почти идентична в штаммах Δ flhD и Δ flhC (рис. S3), как и следовало ожидать, поскольку факторы, вероятно, регулируют одни и те же гены и поскольку делеция flhD оказывает незначительное полярное влияние на flhC . выражение.На рисунке 2 показано полногеномное сравнение нормализованных значений экспрессии в подвижном диком типе MG1655 по сравнению со средней нормализованной экспрессией штаммов Δ flhD и Δ flhC . В целом 228 генов были дифференциально экспрессированы из-за делеции flhD/flhC (рис. 2). Из этих значительно регулируемых генов 40 связаны с сайтами связывания FlhDC, что указывает на прямую регуляцию.

Рисунок 2. Полногеномная экспрессия FlhDC-зависимого гена.

Относительная экспрессия всех генов в подвижном MG1655 по сравнению с относительной экспрессией в Δ flhDC .Значения экспрессии генов представляют собой нормализованные значения экспрессии, рассчитанные Rockhopper. Значения на оси y представляют собой среднее значение нормированных значений экспрессии в штаммах Δ flhD и Δ flhC . Цветовое кодирование указывает, какие гены связаны со связыванием FlhDC (синий) или FliA (зеленый). Гены, не связанные с FlhDC связывания FliA, имеют цветовую кодировку в зависимости от того, значительно ли они регулируются (Rockhopper, q-значение ≤0,01) и изменяются по крайней мере в 2 раза (черный) или нет (серый).

https://doi. org/10.1371/journal.pgen.1004649.g002

Из 11 сайтов связывания FlhDC, идентифицированных с помощью ChIP, 9 связаны с регуляцией одного или нескольких соседних генов (рис. 3A–E, таблица 1). Мы обнаружили сильную положительную регуляцию всех ранее описанных оперонов класса 2 с помощью FlhD и FlhC. Кроме того, данные секвенирования РНК продемонстрировали зависимую от FlhDC активацию yecR , fliDST и нового оперона-мишени ymdABC (таблица 1, рисунок 3B).Сайт связывания FlhDC перед sohB , по-видимому, подавлял экспрессию в 1,95 раза (рис. 3C, таблица 1). Эксперименты RNA-seq не предоставили никаких доказательств регуляции, связанной с новыми сайтами связывания выше ampH/sbmA и gntR (рис. 3D-E, таблица 1).

Рисунок 3. Связывание и регуляция FhDC на известных и новых мишенях.

(A–E) Картированные чтения из экспериментов ChIP-seq и RNA-seq. Интересующие гены и опероны заключены в рамку (черная пунктирная линия) и помечены. На каждой панели обе дорожки данных ChIP-seq масштабируются одинаково, и все три дорожки RNA-seq масштабируются одинаково. Относительные масштабы указаны под каждой панелью. Пунктирные серые линии указывают на то, что сопоставленные чтения превышают показанный масштаб. (F и G) Экспрессия гена относительно mreB , измеренная с помощью RT-PCR. На оси абсцисс указаны названия генов, а в легенде – штаммы (n = 4–7). Статистические сравнения проведены с использованием двухвыборочных Т-тестов между указанными группами: ** p <0.01 (двухвостый).

https://doi.org/10.1371/journal.pgen.1004649.g003

Избранные примеры прямой регуляции, зависящей от FlhDC, или отсутствия регуляции были подтверждены с помощью qRT-PCR (рис. 3F–G). Наличие или отсутствие регуляции было подтверждено для всех протестированных генов, кроме sohB и дивергентно транскрибируемого гена yciK . В то время как данные секвенирования РНК предполагают, что sohB репрессируется в 1,95 раза с помощью FlhDC, а yciK не регулируется, данные qRT-PCR ясно указывают на обратное: отсутствие регуляции sohB и значительная, но незначительная положительная регуляция yciK (1. 5-кратный для FlhD и 2,29-кратный для FlhC; Рисунок 3F–G). Положительная FlhDC-зависимая регуляция yciK также подтверждается экспериментами по комплементации. Небольшие (менее чем в 4 раза), но значимые изменения уровней ampH и sbmA обнаруживаются между диким типом и Δ flhC ; однако эти изменения не обнаруживаются в штамме Δ flhD и не подтверждаются экспериментами по комплементации (рис. 3F-G). Уровни РНК также определяли с помощью qRT-PCR в различных комплементарных штаммах.Как показали анализы подвижности (рис. S1E), сверхэкспрессия flhD могла лишь частично восстановить делецию flhD , но сверхэкспрессия flhDC восстанавливала экспрессию гена-мишени до уровня дикого типа или выше (рис. 3F). Сверхэкспрессия flhC отдельно в делеционном штамме flhD вообще не восстанавливала уровни экспрессии, демонстрируя, что фенотип Δ flhD не был исключительно обусловлен полярным эффектом на экспрессию flhC (). Делеция flhC могла быть полностью дополнена сверхэкспрессией flhC , но экспрессия целевого гена никогда не превышала уровни дикого типа, что позволяет предположить, что уровни экспрессии flhD дикого типа ограничивают возможный пул активных комплексов FlhDC (рис. 3G). .

Механизм прямой регуляции транскрипции с помощью FlhDC

Чтобы лучше понять механизм регуляции FlhDC-зависимых промоторов, ChIP-qPCR использовали для оценки занятости σ 70 FlhDC-зависимых промоторов в штаммах дикого типа и flhD с делецией (рис. 4).Для всех протестированных положительно регулируемых промоторов в штамме дикого типа была обнаружена занятость σ 70 ; однако оккупация σ 70 была полностью неопределяемой в штамме Δ flhD , за исключением промотора yciK / sohB . В этом промоторе делеция flhD значительно снижала, но не устраняла занятость σ 70 , что согласуется с FlhDC-зависимым рекрутированием на промотор yciK и FlhDC-независимым рекрутированием на соседний промоутер sohB . Наши данные предполагают, что связывание FlhDC абсолютно необходимо для рекрутирования σ 70 :RNAP на FlhDC-зависимые промоторы. Это согласуется с сообщениями о том, что эти промоторы плохо совпадают с консенсусными гексамерами -10 и -35 [1].

Рисунок 4. FlhDC необходим для рекрутирования σ 70 :RNAP на FlhDC-зависимые промоторы.

σ 70 обогащение, определенное с помощью ChIP-qPCR, на FlhDC-зависимых промоторах и rpoE (не-FlhDC-промотор) в подвижных MG1655 и Δ flhD (n = 4).Обогащение σ 70 подвижным MG1655 сравнивали с обогащением Δ flhD с использованием двухвыборочного T-критерия: * p <0,05, ** p <0,01 (односторонний).

https://doi.org/10.1371/journal.pgen.1004649.g004

Полногеномное связывание FliA

Чтобы начать оценку следующего уровня транскрипционной иерархии, ChIP-seq использовали для определения полногеномного связывания жгутикового σ-фактора FliA (рис. 5А). После строгого анализа пиков было идентифицировано 52 области, которые не перекрывались с областями, обогащенными немечеными контролями (таблица 2).Эти 52 сайта связывания FliA включают 7 канонических жгутиковых промоторов класса 3 и один перед опероном fliLMNOPQR . Сайты связывания FliA также были идентифицированы выше пяти др. родственных жгутиковым генов, ранее показанных или предсказанных как FliA-зависимые: aer , ycgR , yhjH , trg и tr . Кроме того, сайты связывания FliA были идентифицированы на 4 других ранее описанных FliA-зависимых промоторах нежгутиковых генов: modA [30], ves [20], ynjH [30] и flxA [31]. .Остальные 35 сайтов связывания FliA представляют собой новые промоторы FliA, для которых нельзя найти никаких предыдущих экспериментальных доказательств, хотя небольшая их часть была предсказана различными биоинформационными подходами [51]. Поразительно, 28 из этих новых сайтов связывания находятся внутри генов, и только 4 из этих внутригенных сайтов связывания <300 п. н. выше стартового кодона для соответствующим образом ориентированного аннотированного гена.

Рисунок 5. Полногеномное связывание FliA.

(A) Полногеномное связывание FliA (зеленый цвет), определенное с помощью ChIP-seq.Серые прямоугольники представляют ген в геноме MG1655. (B) Обогащение ChIP-qPCR в одном хорошо известном ( fliC ) и 13 новых сайтах связывания FliA (n = 3, * p <0,05, ** p <0,01). Названия генов в скобках указывают на то, что сайт связывания находится внутри этого гена. (C) Мотив FliA, полученный в этом исследовании (все сайты связывания). (D) Мотив, полученный из сайтов связывания с оценкой FAT ≤4. Мотивы в C и D были созданы с использованием цМемов [52]. (E) Распределение мотивов относительно центров пиков ChIP-seq.Мотивы группируются примерно на 25 нуклеотидов выше по течению от центра пика относительно ориентации мотива.

https://doi.org/10.1371/journal.pgen.1004649.g005

Подмножество предполагаемых сайтов связывания FliA, идентифицированных с помощью ChIP-seq, также тестировали с использованием ChIP-qPCR. Из 13 протестированных новых сайтов связывания FliA 11 продемонстрировали значительное обогащение в этих целевых экспериментах (фиг. 5B). Два новых сайта, которые не могли быть проверены, имели баллы ChIP-seq «кратность превышения порога» (FAT) 4 или ниже.Двадцать два других пика имели такие же низкие оценки пиков (≤4), но не тестировались с помощью ChIP-qPCR. Последовательности, окружающие каждый из 52 сайтов связывания FliA, были выделены и исследованы на наличие мотива с использованием MEME [52]. Очень значимый мотив (значение E = 2,4e -62 ) был идентифицирован во всех 52 областях связывания и хорошо соответствует ранее описанным мотивам промотора FliA (рис. 5C, таблица 2). Этот анализ MEME выявил мотивы, связанные со всеми сайтами с низкой оценкой, включая два, которые не могли быть подтверждены с помощью ChIP-qPCR.Для дальнейшей оценки того, демонстрируют ли сайты с низкой оценкой как группу признаки специфичного для последовательности связывания FliA, мотивы идентифицировали отдельно для высокой оценки (FAT>4, n = 26) и низкой оценки (FAT≤4, n = 26) пики (рис. 5D). Две группы дали очень похожие мотивы, обе с очень значимыми значениями q (значение E высокое  = 5,8e -37 , значение E низкое  = 2,9e -10 ). Это убедительно свидетельствует о том, что большинство пиков ChIP-seq с низкой оценкой представляют собой подлинные специфичные для последовательности события связывания FliA.

Мотивы не только были идентифицированы для всех пиков ChIP-seq, но эти мотивы также были локализованы в поразительном паттерне относительно пиков ChIP-seq (фиг. 5E). Для большинства экспериментов ChIP-seq можно ожидать, что мотивы будут обогащены в центрах пиков [53]. Однако мотивы FliA были сгруппированы с медианным положением 25 нуклеотидов выше центра пика (относительно направления мотива). Это согласуется со связыванием FliA с гексамерными мотивами -10 и -35 в контексте холофермента РНКП [54].Эта локализация мотивов FliA убедительно свидетельствует о том, что FliA связывается только в контексте холофермента РНКП. Кроме того, этот анализ позволил нам идентифицировать два слабых, неканонических, предполагаемых сайта связывания FliA (конвергентная межгенная область insB-4/cspH и внутри proK ), которые имеют необычно локализованные мотивы, что позволяет предположить, что они могут не быть подлинными. Промоутеры FliA.

Пока эта рукопись находилась в стадии подготовки, другая группа опубликовала данные чипа FliA ChIP [55].Наш анализ этого исследования указывает на множество ложноположительных и ложноотрицательных результатов, а разрешение намного ниже, чем у наших данных (рис. S4).

Прямое регулирование FliA

Для обнаружения FliA-зависимых изменений в экспрессии генов была проведена секвенирование РНК в штамме Δ fliA и проведено сравнение с изогенным подвижным диким типом. Анализ дифференциальной экспрессии генов проводили с помощью Rockhopper [36]. В целом, 68 генов были по-разному экспрессированы между подвижным штаммом дикого типа и штаммом Δ fliA (рис. 6).Большинство строго регулируемых генов связаны с сайтами связывания FliA, идентифицированными с помощью ChIP-seq (рис. 6, зеленые точки), что указывает на прямую регуляцию.

Рис. 6. Полногеномная FliA-зависимая экспрессия генов.

Относительная экспрессия всех генов в подвижном MG1655 по сравнению с относительной экспрессией в Δ fliA . Значения экспрессии генов представляют собой нормализованные значения экспрессии, рассчитанные Rockhopper. Зеленые точки представляют гены, связанные со связыванием FliA. Гены, не связанные со связыванием, имеют цветовую кодировку в зависимости от того, регулируются ли они в значительной степени (Rockhopper, q-value≤0.01) и изменился как минимум в 2 раза (черный) или нет (серый).

https://doi.org/10.1371/journal.pgen.1004649.g006

Из 52 сайтов связывания FliA, идентифицированных с помощью ChIP-seq, 14 были связаны со значительными изменениями экспрессии генов в этих условиях (таблица 2, рисунок 7). Среди них были некоторые, но не все, промоторы класса 3 и 8 других промоторов FliA, о которых сообщалось ранее. Интересно, что три внутригенных сайта связывания FliA также связаны со значительной регуляцией окружающих генов.Промоторы внутри flhC , yjdA и yafY управляют транскрипцией нижестоящих генов ( motA , yjcZ и ykfB , соответственно; рис. 2, таблица 7C).

Рисунок 7. Связывание и регуляция FliA с известными и новыми мишенями.

(A–F) Картированные чтения из экспериментов ChIP-seq и RNA-seq. Интересующие гены и опероны заключены в рамку (черная пунктирная линия) и помечены. На каждой панели обе дорожки данных ChIP-seq масштабируются одинаково, и все три дорожки RNA-seq масштабируются одинаково.Относительные масштабы указаны под каждой панелью. Пунктирные серые линии указывают на то, что сопоставленные чтения превышают показанный масштаб. (G) Экспрессия гена относительно mreB , измеренная с помощью RT-PCR. На оси абсцисс указаны названия генов, а в легенде – штаммы (n = 4–7). Статистические сравнения были проведены с использованием двухвыборочных Т-тестов между указанными группами: * p <0,05, ** p <0,01 (двусторонний).

https://doi.org/10.1371/журнал.pgen.1004649.g007

В дополнение к использованию Rockhopper для анализа дифференциальной экспрессии генов, мы визуально изучили картированные данные секвенирования РНК, чтобы найти FliA-зависимые транскрипты, которые в противном случае могли бы остаться незамеченными. Мы идентифицировали необычный транскрипт, связанный с новым сайтом связывания FliA внутри uhpT . В отличие от обсуждавшихся ранее примеров, этот промотор управляет транскрипцией чисто внутригенной РНК. RNA-seq обнаруживает небольшую (~ 50 нт) РНК, закодированную в той же ориентации, что и ген (рис. 7D).Визуальное изучение данных секвенирования РНК также привело к открытию некодирующей РНК антисмысловой ориентации (асРНК), связанной с новым внутригенным FliA-промотором внутри hypD (рис. 7E). Эта asРНК полностью содержится в гене hypD и перекрывает примерно 500 нуклеотидов 5′-конца открытой рамки считывания (ORF) hypD . Антисмысловая РНК hypD экспрессируется слишком слабо, чтобы ее можно было обнаружить с помощью Rockhopper, несмотря на способность программы идентифицировать новые антисмысловые РНК.Оставшиеся новые сайты связывания FliA не были связаны с определяемыми FliA-зависимыми изменениями экспрессии генов в этих условиях (например, speA , фиг. 7F).

Различные канонические и новые примеры FliA-зависимой регуляции были дополнительно подтверждены с помощью qRT-PCR (рис. 7G, таблица S2). Во всех случаях, включая две новые некодирующие РНК, регуляция, выявленная в эксперименте RNA-seq, была подтверждена в этих целевых экспериментах. Кроме того, сверхэкспрессия fliA в штамме Δ fliA приводила к более высоким, чем у дикого типа, уровням экспрессии всех протестированных FliA-зависимых транскриптов.

Двойная регуляция сложных промоторов и перекрывающихся оперонов

Промоторы комплекса

и перекрывающиеся опероны были сначала оценены с использованием наших данных ChIP-seq и RNA-seq (рис. 8). Ранее описанные ( fliAZY [22] и fliLMNOPQR [22]) или предсказанные ( fliDST [24]) комплексные промоторы подтверждаются нашими выводами (рис. 8A, B, D). Ранее описанные перекрывающиеся опероны flgAMN/flgMN также подтверждаются нашими данными (рис. 8C).Наконец, наши данные подтверждают, что flgKL может транскрибироваться как часть вышестоящего FlhDC-зависимого оперона flgBCDEFGHIJ в дополнение к транскрипции с собственного промотора класса 3 (рис. 8C, таблица 2). Хотя эти опероны ранее были описаны у Salmonella [56], [57], это первая экспериментальная демонстрация перекрывающихся оперонов у E. coli . Новый оперон flgBCDEFGHIJKL был дополнительно подтвержден с помощью ОТ-ПЦР для амплификации через границу flgJ-flgK (рис. S5A).

Рис. 8. Связывание и регуляция FlhDC и FliA на двойных регулируемых мишенях.

(A–D) Картированные чтения из экспериментов ChIP-seq и RNA-seq. Интересующие гены и опероны заключены в рамку (черная пунктирная линия) и помечены. На каждой панели обе дорожки данных ChIP-seq масштабируются одинаково, и все три дорожки RNA-seq масштабируются одинаково. Относительные масштабы указаны под каждой панелью. Пунктирные серые линии указывают на то, что сопоставленные чтения превышают показанный масштаб. (E) Экспрессия гена относительно mreB , измеренная с помощью RT-PCR.На оси абсцисс указаны названия генов, а в легенде – штаммы (n = 4–7). Из-за большого количества потенциальных сравнений статистический анализ представлен в таблице S2.

https://doi.org/10.1371/journal.pgen.1004649.g008

В дополнение к подтверждению двойной регуляции fliDST и обнаружению того, что flgKL может транскрибироваться как часть восходящего оперона, данные RNA-seq из этого исследования выявляют неожиданный паттерн для всех жгутиковых генов с двойной регулировкой.В исследованных условиях и фазе роста делеция FliA практически не влияет на уровни экспрессии генов с двойной регулировкой (рис. 8A-D). Это говорит о том, что, хотя присутствие FliA обнаруживается на всех двойных промоторах с помощью ChIP-seq, в наших условиях большая часть транскрипции происходит с FlhDC-зависимых промоторов σ 70 .

Мы использовали qRT-PCR для дальнейшего исследования регуляторного вклада FlhDC и FliA в двойные регулируемые гены (рис. 8E). Как видно из экспериментов RNA-seq, делеция fliA оказывала гораздо менее сильное влияние на экспрессию гена по сравнению с делецией flhD .Сверхэкспрессия fliA в штамме Δ flhD значительно увеличивала уровни РНК всех двойных мишеней (по сравнению с Δ flhD ), показывая, что промоторы FliA способны транскрибировать гены-мишени. Однако этот эффект был меньше для fliL , чем для любого другого двойно регулируемого гена. Кроме того, сверхэкспрессия fliA в штамме Δ fliA (заштрихованная зеленая полоса) снижала экспрессию fliL в 2,10 раза по сравнению с контрольным пустым вектором (сплошная зеленая полоса; t-критерий, p — значение 0. 02), предполагая возможное репрессивное взаимодействие (рис. 8E).

Поскольку двойная регуляция была предложена для всех мишеней класса 2 [23], мы провели аналогичные эксперименты qRT-PCR для этих генов. Сверхэкспрессия fliA в штамме Δ flhD не смогла значительно увеличить экспрессию любой другой протестированной мишени класса 2 (рис. S6). Хотя это и не является статистически значимым, экспрессия flhB действительно увеличивается при сверхэкспрессии fliA (рис. S6).Поскольку flhB находится ниже FliA-зависимого оперона meche , вполне возможно, что оперон flhBAE имеет двойную регуляцию и может транскрибироваться как часть вышестоящего оперона. Тем не менее, нет никаких доказательств ко-транскрипции из RNA-seq или RT-PCR, нацеленных на межгенную область cheZ-flhB (рис. S5B), поэтому мы делаем вывод, что это считывание, вероятно, является артефактом крайней экспрессии FliA. Следует также отметить, что сигнал FliA ChIP-seq не был обнаружен вблизи оперонов flhBAE , fliE или fliFGHIJK , и ни один из этих генов класса 2 не экспрессировался дифференциально в экспериментах с РНК-секвенированием (подвижные штаммы дикого типа и Δ fliA ). Следовательно, за исключением уже обсуждавшихся двойных мишеней, наши данные не подтверждают широко распространенную двойную регуляцию генов класса 2.

Оценка подвижности новых мишеней FlhDC и FliA

Для определения того, были ли необходимы новые цели FLHDC и / или FLIA для моторики, нокауты были сгенерированы для amph , YMDA , SBMA , гнкл , YKFB , YJCZZ , ynjh , гипд и UHPT .Для каждого делеционного штамма определяли подвижность на полужидком агаре. Ни одна из делеций не привела к существенному изменению подвижности (рис. S7), что позволяет предположить, что эти гены не вносят прямого вклада в подвижность в тестируемых условиях.

Обсуждение

FlhDC регулон

Насколько нам известно, это исследование представляет собой первый взгляд на полногеномное связывание in vivo FlhD и FlhC. Мы переопределили прямой регулон FlhDC, идентифицировав новые мишени и показав, что многие ранее зарегистрированные нежгутиковые мишени неверны или не связаны в этих условиях (таблица 1, рисунок S2). Наши данные подтверждают удивительно ограниченный прямой регулон FlhDC и не показывают доказательств того, что какой-либо белок связывает ДНК независимо. В испытанных условиях FlhDC связывается с 11 локусами и напрямую регулирует 11 единиц транскрипции. Однако важно отметить, что некоторые сайты связывания связаны с регуляцией двух дивергентных оперонов, в то время как другие не связаны с какой-либо обнаруживаемой регуляцией. В дополнение к классическим сайтам связывания класса 2 жгутиков наше исследование обнаруживает ранее сообщавшиеся сайты связывания выше yecR и fliDST и 4 новых сайта связывания FlhDC.Два из этих новых сайтов связывания были связаны с обнаруживаемой FlhDC-зависимой регуляцией соседних генов ( ymdA и yciK ), в то время как оставшиеся два не были связаны ( gntR и ampH/sbmA ). Вполне вероятно, что два последних сайта функционируют, возможно, в разных условиях, потому что вероятность появления двух ложных сайтов в межгенных областях очень мала (только ∼11% генома представляет собой межгенную последовательность). Ни один из генов, окружающих 4 новых сайта связывания, не имеет очевидной функциональной связи с синтезом жгутиков, и делеция этих генов не оказала заметного влияния на подвижность (рис. S7).Данные РНК-секвенирования предоставили мало доказательств обширного непрямого регулона FlhDC. В то время как 183 гена регулировались по-разному, но не были связаны со связыванием FlhDC или FliA, степень косвенной регуляции значительно меньше, чем для прямых мишеней (рис. 2; Krustal-Wallis, p <0,0001). FliZ — единственный транскрипционный фактор, регулируемый непосредственно либо FlhDC, либо FliA, и мы не наблюдаем регуляции описанных мишеней FliZ [58]. Следовательно, мы сомневаемся, что FliZ-зависимая регуляция вносит существенный вклад в непрямую FlhDC-зависимую регуляцию, обнаруженную в этом исследовании.Вместо этого вполне вероятно, что косвенно регулируемые гены не представляют собой дополнительный уровень транскрипционной сети FlhDC, а являются результатом физиологических и метаболических изменений, связанных с подвижностью жгутиков.

Несмотря на наличие вырожденного консенсусного мотива, FlhDC, по-видимому, высоко специфично связывается с ДНК — только в 11 сайтах генома. Присутствия одного мотива недостаточно для связывания in vivo , даже в сайтах, которые связаны in vitro (рис. S2).Мы предполагаем, что еще не идентифицированные факторы, такие как конформация ДНК или конкуренция с нуклеоид-ассоциированными белками, играют роль в удивительной специфичности FlhDC.

Хотя присутствие мотива и связывание in vitro с не всегда предсказывает поведение in vivo FlhDC, для жгутиковых сайтов класса 2 обнаруживается поразительный паттерн. Существует совершенная корреляция между зарегистрированным сродством FlhDC in vitro [54], кинетикой экспрессии [59] и оккупацией FlhDC in vivo (данное исследование).В сочетании с данными σ 7 °ChIP, представленными здесь (рис. 4), это предполагает простой механизм активации транскрипции: σ 70 -RNAP не может связывать эти промоторы в отсутствие FlhDC, но по мере увеличения его концентрации, FlhDC связывает ДНК и рекрутирует σ 70 -RNAP на промоторы в порядке относительной аффинности связывания FlhDC. Эта модель временного упорядочения на основе аффинности обычно предсказывается в транскрипционных сетях [60]. Кроме того, это предполагает, что для факторов транскрипции с аналогичным механизмом действия, основанным на рекрутировании, относительная занятость in vivo , полученная из ChIP-seq, может быть использована для предсказания временных паттернов экспрессии.

FliA регулон

Путем сочетания ChIP-seq и RNA-seq мы всесторонне идентифицировали сайты связывания FliA и сопоставили некоторые из них с FliA-зависимыми транскриптами. Мы идентифицировали 52 сайта связывания FliA, 35 из которых являются новыми. Кроме того, мы продемонстрировали, что существующие вычислительные подходы [30], [32], [33], [51] являются плохими предикторами связывания in vivo FliA. Наши данные подтверждают все лучше охарактеризованные члены регулона FliA, но не учитывают большинство промоторов, для которых существуют только биоинформационные прогнозы (таблица S3).Следует отметить, что наши результаты в значительной степени согласуются с предыдущим исследованием экспрессии регулона FliA на микрочипах [20]. Однако мы значительно расширили регулон и определили точные положения промотора, многие из которых отличаются от предсказанных Zhao et al. на основе их данных экспрессии на основе ORF [20].

В условиях, использованных в нашем исследовании, 14 из 52 сайтов связывания FliA были связаны со значительными изменениями уровней РНК одного или нескольких окружающих генов (дикий тип по сравнению с геном дикого типа).Δ fliA ). Это предполагает, как будет обсуждено ниже, что большое количество промоторных последовательностей связывают FliA, но относительно неактивны. Как и в случае с FlhDC, данные секвенирования РНК дают мало доказательств обширного непрямого регулона FliA. Только 40 генов регулировались по-разному, но не были связаны со связыванием FliA. Величина косвенной регуляции была значительно меньше, чем прямая регуляция (рис. 6; Манн-Уитни, p<0,0001). Как и в случае с FlhDC, кажется вероятным, что непрямая регуляция обусловлена ​​вторичными физиологическими и метаболическими изменениями, связанными с подвижностью жгутиков. В соответствии с этой идеей, 29 из 40 косвенно регулируемых генов также косвенно регулируются FlhDC.

Неканонические сайты связывания FliA

Наиболее поразительным результатом наших экспериментов с FliA ChIP-seq является то, что более половины сайтов связывания FliA находятся внутри генов. В то время как о внутригенном связывании сообщалось для др. σ-факторов и многих транскрипционных факторов, пропорция внутригенных сайтов FliA замечательна. Как и в наших выводах, 40% сайтов, связанных с σ-фактором Mycobacterium tuberculosis , SigF, являются внутригенными.Некоторые из этих сайтов связаны с SigF-зависимой транскрипцией в антисмысловой ориентации по отношению к перекрывающемуся гену [61]. Сообщалось, что RpoH (σ 32 ) связывается со многими внутригенными сайтами, но эти сайты составляют только около 25% от общего числа связанных сайтов (22 из 87, [62]). Наконец, недавнее исследование показало, что σ 70 может связываться и инициировать транскрипцию в большом количестве внутригенных сайтов, но это явление репрессируется во многих местах нуклеоид-ассоциированным белком H-NS [63]. В сочетании с нашими результатами FliA, очевидно, важно учитывать инициацию внутригенной транскрипции при анализе данных всего генома.

Из 30 внутригенных сайтов FliA, идентифицированных в нашем исследовании, только 5 связаны с обнаруживаемыми изменениями уровней РНК. Три внутригенных промотора, по-видимому, управляют транскрипцией канонических мРНК нижележащих генов. Два из этих промоторов были точно предсказаны ранее (внутри flhC , управляющего motAB-cheAW [32], [64], и внутри yafY , управляющего ykfB [20]), но один является новым (внутри yjdA). за рулем yjcZ ).Промотор FliA выше yjdA был неправильно предсказан на основании данных экспрессии [20]. Эти три сайта функционируют как канонические промоторы и, вероятно, находятся внутри генов просто из-за пространственных ограничений небольшого генома. Кроме того, два новых внутригенных сайта связывания FliA связаны с обнаруживаемыми малыми внутригенными РНК. Промотор FliA внутри uhpT транскрибирует малую РНК, перекрывающую 3′-конец ORF в смысловой ориентации (рис. 7D), в то время как промотор FliA внутри hypD управляет транскрипцией антисмысловой РНК (рис. 7E).Промотор FliA выше uhpT был предсказан на основании данных об экспрессии [20], но наши данные ясно показывают, что FliA-зависимый транскрипт не является мРНК. Хотя промоторы FliA внутри uhpT и hypD связаны с обнаруживаемой транскрипцией, функции соответствующих РНК неизвестны. Ни одна из внутригенных РНК не демонстрирует признаков регуляции перекрывающихся мРНК. Возможно, что одна или обе эти РНК регулируют мишени, кодируемые транс .

Большинство внутригенных сайтов связывания FliA не связаны с обнаруживаемыми транскриптами. Кроме того, большинство из этих предполагаемых промоторов расположены более чем на 300 нуклеотидов выше стартового кодона до соседнего гена, что делает маловероятным, что они управляют транскрипцией канонических мРНК. Более вероятно, что эти промоторы, если они активны, транскрибируют некодирующие РНК. Однако, поскольку никаких изменений в уровнях локальной РНК, граничащих с этими сайтами связывания, обнаружено не было, остается неясным, представляют ли эти сайты связывания FliA функциональные FliA-зависимые промоторы.Во многих исследованиях сообщается о широко распространенной ложной транскрипции, большая часть которой быстро терминируется и дает крайне нестабильные транскрипты [65]. Следовательно, эти промоторы могут быть активными, но полученные РНК слишком нестабильны, чтобы их можно было обнаружить стандартными методами секвенирования РНК. Три из этих внутригенных промоторов были ранее предсказаны в E. coli , а два из трех, внутри galK и speA , показали FliA-зависимую активность при клонировании выше репортерного гена хлорамфениколацетилтрансферазы [64].Это подтверждает гипотезу о том, что по крайней мере некоторые из внутригенных сайтов связывания FliA являются функциональными промоторами, даже если в нашем исследовании не было обнаружено никаких транскриптов. Альтернативно, эти сайты связывания могут представлять собой промоутер-подобные последовательности, где FliA∶RNAP может связываться, но не может инициировать транскрипцию в тестируемых условиях или потенциально когда-либо. Независимо от их транскрипционной активности, внутригенные сайты FliA могут служить для изменения доступного пула FliA, косвенно влияя на транскрипцию с канонических промоторов, как было предложено для некоторых транскрипционных факторов [66], [67].

Топология сети и последствия двойного регулирования

За последние 15 лет наблюдается растущий интерес к моделированию клеточных процессов как сетей [60]. Было идентифицировано несколько часто встречающихся сетевых мотивов, причем петли прямой связи (FFL) являются одним из наиболее распространенных. В FFLs один регулятор регулирует другой регулятор, и оба регулируют общий ген-мишень (или гены) [68]. Количественная вычислительная модель жгутиковой сети была построена [23] и считается основополагающей работой в области сетевого моделирования [69]. Ключевым аспектом существующей модели жгутиковой сети является то, что все гены класса 2 моделируются как FFL с двойным вводом FlhDC/FliA. Однако наши данные ясно показывают, что три оперона класса 2 (10 генов) не регулируются двойным образом (рис. S6, рис. 9A). Это означает, что истинное поведение транскрипционной сети не может быть точно предсказано существующей моделью.

Рисунок 9. Обновленная жгутиковая сеть транскрипции и локализация целей с двойной регуляцией.

(A) Карта сети транскрипции была обновлена, чтобы точно отображать мишени с двойной регуляцией и включать новые члены регулонов.Овалы вверху слева обозначают положительную (зеленый) и отрицательную (красный) регуляцию транскрипции flhDC . Синие стрелки указывают на трансляцию продуктов генов. Фиолетовые овалы представляют FlhDC, а фиолетовые стрелки указывают на регуляторные взаимодействия FlhDC. Зеленые крестики представляют FliA, а зеленые стрелки представляют регуляторные взаимодействия FliA. Пунктирные стрелки указывают на возможную регуляцию генов, связанных с сайтами связывания, но без детектируемой регуляции в этом исследовании. Целевые гены/опероны заключены в рамки в соответствии с их регуляторным вводом: только FlhDC (зеленый), только FliA (зеленый) и двойные FlhDC и FliA (оранжевый).(B) Локализация и функция продуктов жгутиковых генов, кодированных цветом с помощью регуляторного ввода, как описано для панели B. Генные продукты, физически не связанные с жгутиком, опущены.

https://doi.org/10.1371/journal.pgen.1004649.g009

В дополнение к прояснению общей топологии сети наши полногеномные и целенаправленные эксперименты выявили интересную информацию о регуляторных входах для конкретных двойных мишеней. Выявляется один поразительный паттерн, в то время как связывание FliA легко обнаруживается на всех двойных мишенях, уровни РНК, определяемые с помощью RNA-seq и qRT-PCR, изменяются только умеренно между диким типом и Δ fliA .В большинстве случаев на экспрессию генов с двойной регуляцией влияет менее чем в 4 раза делеция fliA , но более чем в 100 раз делеция flhDC (рис. 8). Это указывает на то, что FliA-зависимая транскрипция вносит очень небольшой вклад в общее количество транскриптов с двойной регуляцией в этих условиях, несмотря на то, что FliA присутствует на ассоциированных промоторах. Несмотря на кажущийся низкий уровень активности этих промоторов FliA, когда fliA сверхэкспрессируется в штамме Δ flhD , экспрессия fliD , flgM и flgK возвращается к уровням дикого типа или выше.Это показывает, что эти промоторы действительно обладают способностью быть очень активными, но еще предстоит выяснить, будут ли когда-либо уровни и активность FliA достаточно высокими, чтобы вызвать активность промотора высокого уровня в клетках дикого типа. Интересно, что сверхэкспрессия fliA приводит к более низкой экспрессии fliL в штаммах Δ flhD и Δ fliA по сравнению со штаммами дикого типа (фиг. 8E). Поскольку промотор FliA находится ниже FlhDC-зависимого промотора σ 70 , мы предполагаем, что высокая занятость FliA∶RNAP дает небольшую FliA-зависимую транскрипцию и фактически конкурирует с σ 70 :RNAP на уровне связывания ДНК для подавления транскрипции. от вышестоящего промоутера.В целом, наши данные предполагают, что жгутиковые гены, вероятно, имеют различные временные паттерны экспрессии из-за разнообразия регуляторных входов на каждом промоторе (рис. 9А).

Теперь, когда мы систематически идентифицировали гены с двойной регуляцией, возникает соблазн предположить, почему одни гены находятся под двойным контролем, а другие нет. Корреляция между классом экспрессии генов (Class 2 или 3) и стадией развития, на которой используются полученные белки, была описана (rev. [3]).Однако продукты генов с двойной регуляцией обнаруживают меньшую закономерность в локализации или корреляции со специфической фазой сборки (рис. 9В). Было показано, что у Salmonella промоторы класса 3 fliDST и flgKL необходимы для роения и быстрого восстановления срезанных жгутиков [57]. Авторы предположили, что эти гены используют свои промоторы класса 2 во время сборки жгутиков de novo , но транскрибируются с промоторов класса 3, независимо от активности FlhDC, для восстановления жгутиков, сломанных во время роения. Возняк и др. также предполагают, что flgMN имеет двойную регуляцию, так что FlgM может точно настраивать активность FliA во время сборки жгутиков и чтобы FlgN мог помогать в складывании и транспорте FlgK во время восстановления жгутиков [57]. Последний оперон с двойной регуляцией, идентифицированный в нашем исследовании, fliLMNOPQR , кодирует компоненты С-кольца и аппарата секреции, локализующиеся в проксимальной части жгутиков (рис. 9В). Наши результаты предполагают, что высокие уровни FliA могут подавлять этот оперон (рис. 8E), но неясно, почему именно эти компоненты могут быть специфически нацелены на отрицательную обратную связь.Альтернативно, FliA может позитивно регулировать оперон fliL на некоторой стадии развития жгутиков, но столь же неясно, почему это необходимо. Специфические роли промоторов класса 2 и класса 3 в мишенях с двойной регуляцией должны быть исследованы далее, чтобы определить физиологическое значение сложных паттернов экспрессии временных генов, возникающих в результате двойной регуляции.

Выводы

Мы идентифицировали множество новых мишеней FlhDC и FliA, включая множество неканонических сайтов связывания FliA.Кроме того, мы пролили новый свет на сложную топологию сети, систематически определяя цели класса 2, класса 3 и объекты с двойным регулированием. Наконец, мы продемонстрировали, что комбинированное применение ChIP-seq и RNA-seq к родственным регуляторам дает достаточно данных для построения модели сети транскрипции с нуля или переопределения даже наиболее охарактеризованных сетей, таких как жгутиковая сеть транскрипции.

Материалы и методы

Штаммы и плазмиды

Бактериальные штаммы, использованные в этой работе, перечислены в Таблице S4.Клетки выращивали в лизогенном бульоне (LB: 1% NaCl, 1% триптон, 0,5% дрожжевой экстракт) или триптонном бульоне (TB: 1% триптон, 0,5% NaCl). Штаммы, несущие плазмиды, культивировали с соответствующим антибиотиком, как указано в таблице S4.

Праймеры

, используемые для создания штаммов, описаны в Таблице S5. Штаммы с эпитопной меткой (DMF11, DMF14, RPB081) были созданы с использованием метода рекомбинации FRUIT [70]. Все штаммы, меченные эпитопом, происходят от AMD052 (MG1655 Δ thyA ), который имеет малоподвижный фенотип.FliA был помечен на N-конце путем вставки метки 3×FLAG после третьей аминокислоты. FlhD и FlhC были помечены путем вставки меток 3 × FLAG во внутренние области петли (рис. S1A). Внутренние сайты были выбраны, поскольку известно или предсказано, что концы обоих белков участвуют в контактах белок-белок и/или белок-ДНК [42], [43]. После отбора по подвижности (см. ниже) в каждом штамме секвенировали область перед flhDC и кодирующую область flhDC (Wadsworth Center Applied Genomic Technologies Core; файл S1).Штаммы DMF62–65 также были созданы с использованием FRUIT. В каждом штамме кассета thyA была вставлена ​​(лицом от flhDC ) в точном месте перед flhDC . вставок thyA были подтверждены с помощью ПЦР и секвенирования (Wadsworth Center Applied Genomic Technologies Core).

Делеционные штаммы

( flhD , flhC и fliA ) также были созданы с использованием рекомбинации. Во-первых, DMF35 был получен из AMD052 путем отбора подвижности, как описано ниже.С DMF35 в качестве общего исходного штамма FRUIT использовали для получения делеций без рубцов flhD (DMF38) и fliA (DMF40). Делеционный штамм flhC (DMF58) был получен путем амплификации аллеля flhC ::kan из коллекции Keio [71], его электропорации в DMF35 и последующего удаления кассеты kan путем экспрессии рекомбиназы FLP из pCP20 [72]. После вставки метки или делеции гена thyA повторно вводили в его нативный локус, и штаммы излечивались от всех плазмид.Штаммы DMF50–57 также были получены из AMD052 с использованием FRUIT для замены представляющих интерес генов геном thyA . Обратите внимание, что у этих штаммов отсутствует thyA в его нативном локусе, но они имеют фенотип thyA + . Плазмиды со сверхэкспрессией были созданы путем клонирования интересующей ORF в pBAD24 [73], вырезанной с помощью NheI и SphI (NEB) с использованием метода In-Fusion (Clontech). Все делеционные штаммы и плазмиды были проверены с помощью ПЦР и секвенирования (Wadsworth Center Applied Genomic Technologies Core).

Отбор подвижности для получения подвижных изолятов

Наш лабораторный изолят MG1655 и родственный штамм AMD052 демонстрировали малоподвижный фенотип. ПЦР с использованием JW3100 и JW5358 показала, что у этих штаммов отсутствует элемент IS выше по течению от flhDC , который необходим для подвижности высокого уровня. Штаммы, меченные эпитопом, были получены из AMD052 и, таким образом, изначально также были малоподвижными. Чтобы выделить высокоподвижные производные, насыщенные ночные культуры штаммов AMD052 и предварительно меченные эпитопом штаммы наносили (5 мкл) на мягкий агар TB (0.3%) и инкубировали при 30°С. Подвижные субпопуляции начали появляться между 20 и 24 часами. Обычно мы наблюдали 1–5 подвижных субпопуляций на каждой чашке. Подвижные клетки собирали из палочек, получая подвижные штаммы DMF35, DMF11, DMF14 и RPB081. Вставку IS-элемента подтверждали с помощью ПЦР и секвенирования с использованием олигонуклеотидов JW3100 и JW5358 (Wadsworth Center Applied Genomic Technologies Core; файл S1).

Анализ подвижности

Ночные культуры выращивали в ТБ при 30°С. Насыщенные культуры (5 мкл) высевали на мягкий агар TB 155 мм (0.2%) и инкубировали при 30°С. Каждый планшет включал DMF36 для сравнения и 1–4 других представляющих интерес штамма. Каждый анализ проводили 5 раз для независимых ночных культур. Изображения делались с часовыми интервалами через 4–6 часов после инокуляции. Репрезентативные изображения показаны на рисунке S1 и S7.

Чип-КПЦР

Штаммы

DMF11, DMF14, RPB081 и DMF36 использовали во всех экспериментах с ChIP. Субкультуры выращивали в LB при 37°C с аэрацией до OD 600 , равной 0.5–0,7. Культуры собирали, сшивали, обрабатывали ультразвуком и иммунопреципитировали, как описано ранее [74], с небольшими модификациями. Анти-FLAG (2 мкл на IP, M2 моноклональный; Sigma) или анти-σ 70 (1 мкл на IP; Neoclone) антитела использовались для всех иммунопреципитаций, как для ChIP-qPCR, так и для ChIP-seq. Чип и исходную ДНК очищали с помощью набора Zymo PCR Clean and Concentrate. Образцы анализировали с помощью количественной ПЦР, как описано ранее [74]. Олигонуклеотиды, используемые для амплификации контрольной области bglB и представляющих интерес областей, описаны в таблице S6.В экспериментах ChIP-qPCR использовали 3–7 биологических повторов на штамм. Полные данные ChIP-qPCR представлены в таблице S1.

Подготовка библиотеки ChIP-seq и секвенирование

Культуры для экспериментов ChIP-seq выращивали, как описано для ChIP-qPCR. Библиотеки ChIP-seq были сконструированы и секвенированы, как описано ранее [63], за исключением одного повтора FlhC-FLAG, который был приготовлен, как описано [37]. Используемые антитела были такими же, как и для ChIP-qPCR. Библиотеки ChIP-seq были сконструированы и секвенированы для 2 биологических повторов на штамм. Секвенирование проводили на приборе Illumina Hi-Seq (Университет Буффало, SUNY).

Анализ данных ChIP-seq

последовательности были сопоставлены с геномом MG1655 (NC_000913.2) с использованием CLC Genomics Workbench. Сопоставленные чтения были собраны и записаны в файл .gff с использованием пользовательского скрипта Python и просмотрены в SignalMap (Nimblegen). Все изображения ChIP-seq, представленные в этом исследовании, получены из SignalMap и обработаны в программном обеспечении для редактирования изображений GIMP, чтобы выделить базовые линии (нулевые считывания) и заполнить пробелы в данных, возникающие из-за артефактов изображения.

Почти все программы анализа ChIP-seq были разработаны и оптимизированы для эукариотических данных ChIP-seq и, по нашему опыту, плохо работают с бактериальными данными ChIP-seq. Мы создали специальные сценарии Python для определения пиков в данных ChIP-seq бактерий. Во-первых, все наборы данных были нормализованы до 100 миллионов чтений. Пары повторяющихся наборов данных рассматривались вместе. Для каждого повторяющегося набора данных в паре был определен соответствующий порог. Плюсовые и минусовые пряди рассматривались отдельно.Для первой повторности для данной нити в качестве порога было выбрано значение T 1 . Для второй повторности в качестве порога было выбрано значение T 2 . Значения для T 1 и T 2 рассматривались между 1 и 1000. Для каждой комбинации значений для T 1 и T 2 значения генома ≥ 2 2 T 1 в первой повторности и со значениями ≥ T 2 во второй повторности.Частота ложных открытий оценивалась с использованием нулевой гипотезы о том, что никакие области не обогащены. Была выбрана комбинация порогов, дающая наибольшее количество истинных положительных позиций с оценочной частотой ложных обнаружений менее 0,01. Как только были выбраны T 1 и T 2 , пиковый вызов был выполнен, как описано ранее (дополнительный материал [54]). Вкратце, область идентифицировали как пик, если оба повтора демонстрировали обогащение выше соответствующих порогов для каждой цепи.Для вызова пика должен быть пик на положительной цепи в пределах порогового расстояния от пика на отрицательной цепи, как описано ранее (дополнительный материал к [54]). Чтобы идентифицировать области искусственного обогащения, пики, идентифицированные в меченых штаммах, сравнивали с пиками, вызванными в контрольном эксперименте ChIP-seq с использованием немеченого штамма (DMF35). Для каждого фактора рассчитанные значения T были скорректированы, чтобы отразить общее количество прочтений в повторах контрольного эксперимента, а затем применены для определения пика в контролях.Любые области, для которых был назван пик в истинном эксперименте ChIP-seq и в контрольном эксперименте без метки в пределах 50 п.н. друг от друга, считались потенциальными артефактами и исключались из дальнейшего анализа.

Выделение РНК и подготовка библиотеки секвенирования РНК

Штаммы

DMF36, DMF38, DMF58 и DMF40 использовали для экспериментов по секвенированию РНК. Субкультуры выращивали в LB при 37°C с аэрацией до OD 600 0,5–0,7. РНК очищали модифицированным методом горячего фенола, как описано ранее [37].После выделения РНК обрабатывали ДНКазой (TURBO DNA-free kit; Life Technologies) в течение 45 минут при 37°C с последующей экстракцией фенолом и осаждением этанолом. рРНК удаляли с помощью набора RiboZero (Epicentre) и конструировали библиотеки специфичных для цепей ДНК с использованием набора ScriptSeq 2.0 (Epicentre). Секвенирование проводили с использованием прибора Illumina Hi-Seq (Университет Буффало, SUNY).

Визуализация данных секвенирования РНК и анализ дифференциальной экспрессии

чтения последовательности были картированы и визуализированы, как описано выше.Дифференциальный анализ экспрессии проводили с использованием Rockhopper [36] с параметрами по умолчанию. По предложению разработчиков изменения в экспрессии генов считались статистически значимыми, если q -value≤0,01. Гены должны были регулироваться как минимум в 2 раза, чтобы считаться значительно дифференциально регулируемыми. Рибосомные РНК (рРНК) были исключены из анализа секвенирования РНК, поскольку рРНК была удалена во время подготовки библиотеки.

Выделение РНК и qRT-PCR

Штаммы

pDMF9–18 использовали для экспериментов с qRT-PCR.Субкультуры выращивали в LB+100 мкг/мл ампициллина при 37°С с аэрацией до OD 600 0,4–0,6. Добавляли арабинозу до конечной концентрации 0,2% и культуры инкубировали при 37°С в течение дополнительных 10 минут. РНК выделяли следующим образом. 10 мл культуры собирали центрифугированием, ресуспендировали в 1 мл реагента Trizol (Life Technologies) и инкубировали при комнатной температуре в течение 5 мин. Образцы центрифугировали, супернатанты переносили в новые пробирки и добавляли 200 мкл хлороформа.Образцы хорошо перемешивали, инкубировали при комнатной температуре в течение 3 минут и центрифугировали. Водные слои переносили в новые пробирки и смешивали с 500 мкл изопропанола. Образцы хорошо перемешивали, инкубировали при комнатной температуре в течение 10 минут и центрифугировали для сбора осажденной РНК. Гранулы однократно промывали 75% этанолом и затем сушили. РНК ресуспендировали в H 2 O и обрабатывали ДНКазой TURBO (Life Technologies), как описано выше. РНК подвергали обратной транскрипции с использованием обратной транскриптазы SuperScript III (Invitrogen) со 100 нг случайного гексамера в соответствии с инструкциями производителя.Контрольную реакцию без обратной транскриптазы (без ОТ) проводили для каждого образца. кДНК и образцы без ОТ разводили и использовали в качестве матриц для количественной ПЦР. кПЦР выполняли на машине ABI 7500 Fast для ПЦР в реальном времени. Олигонуклеотиды, используемые для амплификации генов-мишеней, и контроль ( mreB ) перечислены в Таблице S7. Относительные значения экспрессии рассчитывали с использованием модифицированного метода 2 -ΔΔCt [75]. Первые целевые значения Ct были нормализованы к контролю ( mreB ), что дало значения ΔCt, затем 1.9 -ΔCt (при условии несовершенной эффективности ПЦР) рассчитывали для каждой мишени в каждом штамме. Наконец, значения экспрессии во всех штаммах были нормализованы к среднему значению 1,9 -ΔCt в подвижном MG1655+pBAD. В экспериментах qRT-PCR использовалось 3–4 биологических повтора на штамм, и все реакции qPCR проводились в трех повторностях.

Вспомогательная информация

Рисунок S1.

Конструирование и проверка деформации. (A) Расположение меток для внутренней маркировки 3×FLAG для FlhD и FlhC.Черные линии представляют собой неструктурированные области, красные цилиндры представляют собой α-спирали, а синие прямоугольники представляют собой β-листы. Золотые звездочки представляют собой Zn-связывающие остатки цистеина. На вставках показана аминокислотная последовательность, окружающая места вставки метки. (B) Расположение, идентичность и направление вставок IS-элементов, присутствующих в каждом штамме, отобранном по подвижности. Прямоугольники представляют области, которые дублируются во время вставки. (C) Мягкая агаровая подвижность подвижного MG1655 и штаммов, в которых кассета thyA была вставлена ​​в каждое из мест вставки IS-элемента, описанных выше. (D) Мягкая подвижность агара подвижных штаммов MG1655 и меченых эпитопом штаммов. (E) Мягкая подвижность агара подвижного MG1655, изогенные делеции и комплементарные штаммы. Обратите внимание, что Δ flhC+ p flhC неподвижен из-за разрушения промотора оперона motAB-cheAW .

https://doi.org/10.1371/journal.pgen.1004649.s001

(PDF)

Рисунок S2.

Наличие мотива FlhDC и связывание in vitro не предсказывает связывание in vivo . Стаффорд и др. [25] предсказал сайты связывания FlhDC на основе консенсусного мотива охарактеризованных сайтов связывания. Сайты, показанные на этой фигуре, хорошо соответствовали консенсусу и демонстрировали слабое связывание in vitro с . За исключением fliD и yecR (не показаны), ни один из предсказанных сайтов не показал связывания FlhDC in vivo в целевых анализах ChIP-qPCR (n = 4, * p <0,05, ** p <0,01).

https://doi.org/10.1371/journal.pgen.1004649.s002

(PDF)

Рисунок S4.

Сравнение мотивов FliA из этого исследования и Cho et al. [ 55 ] . Мотивы были созданы из последовательностей, окружающих сайты связывания, идентифицированных только в нашем исследовании (n = 27) или только в Cho et al. (n = 29). (A) Сайты связывания FliA, уникальные для нашего исследования, дали очень значимый мотив (27/30 сайтов, E-value = 1,5e-27), аналогичный описанному для FliA.(B) Мотив с наибольшей оценкой для областей связывания FliA, уникальный для Cho et al. , значительно не обогащен и не проявляет сходства с описанными мотивами FliA (мотив с наибольшей оценкой: 10/29, E-значение   =  3,5). Следует также отметить, что Cho et al. не смогли обнаружить некоторые хорошо охарактеризованные промоторы FliA, такие как промоторы выше по течению от fliAZY и fliC .

https://doi.org/10.1371/journal.pgen.1004649.s004

(PDF)

Рисунок S5.

flgJK имеет двойное регулирование, а flgBAE — нет. (A) RT-PCR с использованием вышестоящего праймера в пределах flgJ и нижележащего праймера в пределах flgK дала полосу ожидаемого размера в подвижном MG1655, но не в Δ flhD . Это подтверждает, что flgKL может транскрибироваться как часть вышестоящего FlhDC-зависимого оперона. Дорожки, помеченные как «колония», представляют собой ПЦР-контроль колонии (геномная ДНК), «+RT» представляют собой ОТ-ПЦР, а «-RT» представляют собой контроли, в которых обратную транскриптазу не добавляли во время синтеза кДНК. (B) ОТ-ПЦР с использованием предшествующего праймера в пределах cheZ и нижнего праймера в пределах flhBAE дала очень мало продукта.Продукт слегка увеличивался по сравнению с контролем -RT, когда fliA сверхэкспрессировался. Маловероятно, что это небольшое количество считываний при очень высоких уровнях FliA будет физиологически значимым.

https://doi.org/10.1371/journal.pgen.1004649.s005

(PDF)

Рисунок S6.

Все гены класса 2 не транскрибируются FliA. Экспрессия flgA , flgB и fliF не может быть восстановлена ​​сверхэкспрессией FliA в Δ flhD .Экспрессия flhB умеренно повышена в штамме Δ flhD +pBAD- fliA , возможно, из-за считывания вышестоящего FliA-зависимого tar-tap-cheRBYZ (см. Рисунок S4).

https://doi.org/10.1371/journal.pgen.1004649.s006

(PDF)

Жгутиковые крючки и белок крючка FlgE участвуют во взаимодействии микробов-хозяев на иммунологическом уровне

Дизайн исследования

WT и мутантные белки FlgE, соответствующие белку FlgE P.aeruginosa клонировали и экспрессировали в E. coli с последующей аффинной очисткой и удалением эндотоксина. Эти рекомбинантные белки использовали для лечения HCEC, срезов легких мышей или мышей. Чтобы изучить функцию FlgE в жгутиковом крючке, WT P. aeruginosa подвергали мутации FlgE с получением трех мутантов, представляющих разные мутации. Следили за влиянием мутаций на образование жгутиков или подвижность бактерий. Крючки очищали от бактерий и оценивали их иммуностимулирующие эффекты, как и для рекомбинантного белка FlgE.Основные показатели во всех исследованиях включают экспрессию на уровне мРНК или белка, обнаруженную с помощью микрочипа и RT-qPCR или ELISA, соответственно. Чтобы идентифицировать возможные рецепторы или связывающие молекулы для стимуляции FlgE, использовали аффинную хроматографию для удаления белков, взаимодействующих с FlgE, которые затем подвергали масс-спектральному анализу. Наиболее многообещающий кандидат, здесь CAV1, был дополнительно подтвержден у мышей с дефицитом CAV1. Было выполнено трехмерное моделирование FlgE и FlgEM, чтобы понять структурную основу функции FlgE.

Животные

Протоколы экспериментов на животных были одобрены Комитетом по этике Университета Сучжоу и соответствуют Руководству по гуманному обращению с лабораторными животными (Министерство науки и технологий Китая, 2006 г.). Мыши C57BL/6 были приобретены у компании Vital River Laboratory Animal Technology Co. (Пекин, Китай). CAV1-дефицитные (CAV1 -/- ) селекционеры были получены из лаборатории Джексона и содержались в лаборатории Лю в Хунаньском университете традиционной китайской медицины. Мышей OTII (лаборатория Джексона, Бар-Харбор, Мэн) скрещивали с CD45.1 + (Ly5.1) мышей (лаборатория Джексона) для получения мышей CD45.1 × OTII F1 в лаборатории Tang в Тайшаньском медицинском университете. Все мыши содержались в условиях, свободных от специфических патогенов (SPF), на стандартной диете и воде, и их использовали, когда им было примерно 6–8 недель.

Дизайн и экспрессия рекомбинантных FlgE и FlgEM

Подробности конструирования вектора и экспрессии WT PAO1 FlgE ранее сообщались в китайском журнале 20 . Вкратце, фрагмент, кодирующий FlgE, амплифицировали из геномной ДНК, выделенной из штамма PAO1 (ATCC27853, Американская коллекция типовых культур, Манассас, Вирджиния), с использованием ПЦР.Праймеры были сконструированы в соответствии с геномным регистрационным номером AE004901 с добавлением сайтов рестрикционных ферментов Nde I и Hind III на 5′-концах (вперед: GGAATTC CATATG AGTTTCAACATCGGCTG; в обратном направлении: TCCC AAGCTT GCGATGTCAGGTTT). GenScript (Нанкин, Китай). ПЦР проводили с помощью PCR MasterMix (Tiangen Biotech, Пекин, Китай), продукты расщепляли рестрикционными ферментами Nde I и Hind III, а извлеченные фрагменты клонировали в прокариотический вектор экспрессии pET24a (Novagen, Сан-Диего, Китай). CA) с использованием сайтов Nde I и Hind III.После обычной трансформации и посева были отобраны клоны, устойчивые к канамицину, и выделенные плазмиды были секвенированы как по гену-мишени, так и по участкам сцепления, включая 6 × His-метку на С-конце. Правильная рекомбинантная плазмида была названа pET24a- flgE . Чтобы изучить корреляцию между структурой и активностью FlgE, два сайта, которые были гомологичны двум PhD-пептидам из предыдущего исследования 17 (также см. рис. S1), были выбраны для мутации для создания FlgEM.Фрагмент, кодирующий рамку считывания, аналогичную PAO1 FlgE, был синтезирован Genewiz Biotechnology (Пекин, Китай), за исключением того, что были введены две мутации. Первая мутация представляла собой вредное изменение сайта B в нуклеотидах 1166383–1166403 AE004901, а именно строку CCGCCGACCGTGACGCCGTTC, а вторая мутация представляла собой замену сайта F (ACCCCGCCGACCTACGCCTGG, нуклеотиды 1166788–1133808 AE004901) на GCAGCAGCA. Эти изменения привели к делеции семи аминокислот в сайте B (PPTVTPF, aa168–174) NP_249771 и замене семи аминокислот в сайте F (TPPTYAW, aa303–309, NP_249771) тремя последовательными аланинами (AAA).Синтетический фрагмент был предоставлен производителем в клонирующем векторе pUC57 между сайтами Nde I и Hind III. После расщепления рестрикционными ферментами Nde I и Hind III фрагмент выделяют и клонируют в pET24a, как описано выше, получая в результате плазмиду, названную pET24a -flgEM .

Для получения рекомбинантных белков FlgE и FlgEM плазмиды pET24a -flgE и pET24a -flgEM трансформировали в компетентные клетки BL21(DE3) (Novagen), а положительные клоны выращивали в бульоне LB с 50 мг/л канамицина. при перемешивании при 225 об/мин и 30 °C.Когда OD 600 составляла 0,6–0,9, IPTG (Sigma, Сент-Луис, Миссури) добавляли до 1 мМ и культуру выращивали при 225 об/мин и 16 °C в течение еще 20 часов. Культуру собирали с использованием связывающего буфера (20 мМ фосфата натрия, 0,5 мМ NaCl, 30 мМ имидазола, pH 7,4), содержащего 0,03 мкг/л лизоцима, и обрабатывали ультразвуком на льду. Пилотные эксперименты показали, что экспрессированные белки растворимы; поэтому супернатант, содержащий сверхэкспрессированные белки, подвергали аффинной хроматографии с использованием колонок His-Trap Fast Flow Crude (GE Healthcare, Бакингемшир, Великобритания) в системе Akata FPLC (GE Healthcare) в соответствии с инструкциями производителя.Элюированные белки пропускали через колонку для обессоливания His-Trap (GE Healthcare), а затем использовали набор для удаления эндотоксинов Toxin Eraser TM (GenScript, Piscataway, NJ). Было подтверждено, что окончательные элюции содержат отдельные полосы вокруг ожидаемых молекулярных масс (FlgE, молекулярная масса 48336,08; FlgEM, молекулярная масса 46992,53) соответственно на 12% геле SDS-PAGE. Всего в этом исследовании было испытано три партии FlgE или FlgEM, и между этими препаратами не было отмечено существенных различий (данные не представлены).Эндотоксин в этих белковых препаратах измеряли с помощью анализа лизата амебоцитов тахиплеуса (CE-TAL) с конечной точкой хромогенности (Rongbo Biotechnology, Шанхай, Китай), и он присутствовал на уровне менее 0,74 ЕЭ/мг, что было незначительным для последующих исследований.

Получение

P. aeruginosa Жгутиковых крючков

Жгутиковые крючки штамма WT PAO1 очищали в соответствии с процедурой, описанной Limberger 47 . Вкратце, бактериальные культуры собирали в поздней логарифмической фазе роста, ресуспендировали в PBS и подвергали стрижке путем проталкивания их через иглу для подкожных инъекций 22 размера несколько раз.Целые клетки и дебрис удаляли низкоскоростным центрифугированием (8000×g, 15 мин), а очищенный супернатант подвергали ультрацентрифугированию при 75000×g в течение 1 ч для получения очищенных нитей (с крючком). Затем нити диссоциировали кислым буфером (50 мМ глицин-тритон Х-100, рН 2,5) при 25 °С в течение 1 часа и крючок собирали ультрацентрифугированием (100 000 × g, 60 мин). Осадок ресуспендировали в 10 мМ трис-HCl-буфере, pH 7,5, и измеряли концентрацию белка с помощью набора от Applygen Technologies Inc.(Пекин, Китай) с использованием методологии бицинхониновой кислоты (BCA) 48 .

Эффекты FlgE или FlgEM на экспрессию генов в HCEC

Для исследований биоанализа in vitro HCEC (CRL-11135, ATCC) высевали на 24-луночные планшеты при 1,5 × 10 Среда (DMEM)/F12 с добавлением 10% термоинактивированной FBS (Invitrogen, Carlsbad, CA) при 37 °C. При достижении 80–90% слияния клетки голодали в течение 4 ч в культуральной среде без бычьей сыворотки, а затем добавляли FlgE или FlgEM до 20 мкг/мл, если не указано иное, в течение 4 ч в трех повторностях.После инкубации клетки собирали с помощью TRIzol (Qiagen, Валенсия, Калифорния) и экстрагировали РНК. Образцы РНК подвергали микрочиповому анализу или ПЦР в реальном времени (RT-qPCR), как описано ниже.

Культуры легочных органоидов

Культуры легочных органоидов использовали в качестве модели in situ для сравнения уровней биологической активности FlgE, FlgEM и жгутиковых крючков на изолированных тканях животных. После умерщвления мышей легкие удаляли и перфузировали холодным PBS, а затем закапывали предварительно нагретой 2% низкоплавкой агарозы в PBS до их приблизительного исходного размера.После затвердевания легкие разрезали на ломтики толщиной 1 мм с помощью специального инструмента. Ткани подвергали воздействию предварительно определенных концентраций рекомбинантных FlgE, FlgEM, жгутиковых крючков, LPS или носителя (PBS) в 24-луночных планшетах, содержащих бессывороточную DMEM. После обычного культивирования при 37°C в течение 24 ч срезы легких собирали и подвергали детекции генов с помощью RT-qPCR, как описано выше. В некоторых случаях во время культивирования добавляли U0126 (Cat # 9903, Cell Signal Technology, Дэнверс, Массачусетс) до концентрации 10 мкМ.Для подтверждения участия CAV1 в стимуляции FlgE мышей CAV1 -/- также использовали параллельно с мышами дикого типа. Для всех анализов и в каждой обработке были установлены дубликаты. Использовали трех мышей, и для каждого отдельного лечения смешивали и подвергали культивированию равное количество срезов от каждой из трех мышей.

Провоспалительная активность FlgE у мышей

Для выявления провоспалительных эффектов FlgE или FlgEM in vivo мышам C57BL/6 интраназально вводили 150 мкл раствора, содержащего 120 мкг рекомбинантного FlgE, FlgEM, LPS или носителя PBS. Только.В каждую группу включали по шесть мышей. Всех животных умерщвляли через 24 часа и проводили бронхоальвеолярный лаваж тремя аликвотами по 1 мл стерильного физиологического раствора. Цитокины в лаваже измеряли с использованием наборов ELISA для мышиных IL1β, IL6 и CXCL1 (Cusabio Biotech, Ухань, Китай), а активность МПО в сыворотке измеряли с использованием набора для определения МПО (Nanjing Jiancheng Corp., Нанкин, Китай). Легкие были удалены и разрезаны пополам. Одну половину фиксировали в 4% формальдегиде, заливали в парафин и разрезали на срезы толщиной 4 мкм для окрашивания гематоксилином и эозином (H&E), а другую половину подвергали генной детекции с использованием RT-qPCR, как описано выше.

Адъювантность FlgE на растворимом антигене у мышей

Для изучения потенциальной адъювантности FlgE на животных использовали OVA в качестве растворимого антигена для иммунизации мышей, получавших OVA-специфические Т-клетки. Вкратце, селезенки и паховые лимфатические узлы удаляли у мышей CD45.1 × OTII F1 и пропускали через нейлоновую сетку размером 70 мкм для получения отдельных клеток. Клетки метили eFluor450, CD16/32 и смесью антител (по 1 мкг/мл каждого из CD45.1-FITC, CD4-Percp/Cy5.5, TCRvalpha2-APC/Cy7, TCRvbeta5-APC, CD62L-PE, и CD25-BV650, все от eBioscience, Сан-Диего, Калифорния) последовательно перед сортировкой с помощью шариков MACS CD4 + (Miltenyi Biotec GmbH, Бергиш-Гладбах, Германия), а извлеченные клетки CD4 + дополнительно сортировали с использованием BD. FACSAria II (BD Biosciences, Сан-Хосе, Калифорния) для CD4 + CD45.1 + TCRvalpha2 + TCRvbeta5 + CD62L + CD25 фракций. Очищенные наивные Т-клетки переносили самкам мышей C57BL/6 в количестве 1 × 10 6 клеток/мышь посредством инъекции в хвостовую вену. Через 24 часа реципиентов иммунизировали путем подкожной инъекции в основание хвоста одной из восьми композиций в 100 мкл, а именно OVA (1 мкг), OVA плюс 50 мкг CpG-1826 (оба от Sigma, Сент-Луис, США). MO), OVA плюс 50 мкг FlgE, OVA плюс 100 мкг FlgEM, 50 мкг CpG-1826, 100 мкг FlgE, 100 мкг FlgEM или контроль PBS.Три дня спустя мышей умерщвляли, и дренирующие паховые лимфатические узлы выделяли, визуализировали и измельчали ​​в одноклеточную суспензию для окрашивания CD45.1 и CD4, как описано выше. Клетки запускали на BD FACSAria II и анализировали на интенсивность eFluor450, чтобы отразить пролиферацию. Чтобы измерить, изменил ли FlgE гуморальный ответ животных-хозяев на OVA, мышей WT C57BL/6 иммунизировали только OVA (100 мкг), OVA плюс 100 мкг FlgE, OVA плюс FlgEM 100 мкг, OVA плюс 50 мкг CpG или лечили 50 мкг CpG, 100 мкг FlgE, 100 мкг FlgEM по отдельности в качестве контроля, все путем подкожной инъекции.Через две недели мышей забивали для сбора сыворотки и измеряли титры анти-OVA с помощью ELISA. Для этой цели 96-луночные планшеты покрывали 100 мкл OVA в PBS (20 нг/мл) в течение ночи при 4°C, а затем блокировали 1% FBS в буфере PBS на 1 час при комнатной температуре. Добавляли серийные разведения сыворотки и инкубировали в течение 2 часов при комнатной температуре с последующим промыванием и инкубацией с крысиным антимышиным IgG1 или IgG2b-биотиновым антителом в концентрации 0,125 мкг/мл в течение двух часов. После промывки лунки инкубировали со стрептавидином-HRP в течение 30 мин при комнатной температуре.Затем планшеты трижды промывали и в каждую лунку добавляли раствор 3,3′,5,5′-тетраметилбензидина (ТМБ). После 20 мин инкубации реакцию останавливали добавлением 50 мкл 1 М H 2 SO 4 и планшеты считывали с помощью ридера микропланшетов при 450 нм.

Трехмерное моделирование FlgE/FlgEM

Белковая последовательность PAO1 FlgE (NP_249771 или Q9I4P9) была получена из базы данных UniProt (http://www.uniprot.org). Программа BLASTP впоследствии использовалась для поиска гомологов FlgE в базе данных белков RCSB (http://www.pdb.org). Следовательно, было установлено, что FlgE из S. typhimurium (идентификационный код PDB: 3A69) 28 имеет 35,7% идентичности и 54,5% сходства с PAO1 FlgE, что делает его предварительным шаблоном для структурных предсказаний последнего. Затем трехмерная структура FlgE была смоделирована с помощью программы MODELER в пакете Discovery Studio 4.0 (Accelrys Inc., Сан-Диего, Калифорния, США) 49 и оптимизирована с использованием минимизации энергии с помощью силового поля Амбера и постепенно минимизирована (водороды, боковые цепи, все), чтобы облегчить любые оставшиеся плохие стерические контакты.Оптимизированная трехмерная структура была наконец оценена с использованием Procheck и Profiles-3D для изучения стереохимического качества и структурной рациональности.

Анализ микрочипов

Экстракцию РНК из HCEC и последующие процедуры микрочипов выполняла компания Shanghai OE Biotech (Шанхай, Китай), работавшая по контракту с Agilent. Вкратце, общую РНК экстрагировали с использованием мини-набора QIAGEN RNeasy, а биоанализатор Agilent 2100 использовали для подтверждения того, что качество РНК всех образцов было достаточно высоким, о чем свидетельствуют числа целостности РНК, превышающие 9.9 и 28S/18S больше 1,6. Двести нанограммов РНК обратно транскрибировали в кДНК с использованием полиТ-праймера, меченного промотором Т7. Полученную кДНК транскрибировали в кРНК, во время которой флуоресцентные метки Cy3 и Cy5 вводили в образцы групп, получавших FlgE, и групп контроля среды, соответственно. Гибридизацию проводили на массиве Agilent SurePrint G3 Human Gene Expression 8 ×60 K (кат. № G2543-60015, Agilent) с использованием печи Agilent G2545A в течение 17 часов при 65 °C. Эти массивы обнаружили 34 745 транскриптов, кодирующих белок, и 7660 LncRNA, а также внутренние зонды для контроля качества.Для сканирования гибридных массивов использовали сканер Agilent G2505C. Каждый массив сканировался дважды с разрешением 5 мкм, фотоумножителем (ФЭУ), коэффициентом усиления 100% и 10%, а результаты сканирования объединялись для окончательного извлечения с использованием Feature Extraction. Извлеченные данные флуоресценции нормализовали и анализировали с использованием GENESPRING12.0 (Silicon Genetics, Redwood City, CA). Только признаки, отмеченные как ОБНАРУЖЕННЫЕ как минимум в двух из трех массивов, считались «выраженными» и использовались в последующем анализе.Для каждого зонда экспрессированного гена соотношение FlgE/контроль (т.е. кратное изменение) было получено для каждого массива, и было рассчитано значение P для сравнения интенсивностей флуоресценции в этих двух группах. Среднее кратное изменение больше 1,50 или меньше 0,667 для всех трех массивов с P < 0,10 между FlgE и контрольной группой было произвольно выбрано для оценки значительного повышения или понижения регуляции соответственно. Дифференциально экспрессируемые гены были аннотированы и сгруппированы с помощью DAVID (v6.7, NIH, Бетесда, Массачусетс), на фоне всего генома человека 50 . Данные микрочипа соответствуют требованиям MIAME и были депонированы в Gene Expression Omnibus (NBCI, NIH) под инвентарным номером GSE58422.

ПЦР в реальном времени (RT-qPCR)

RT-qPCR использовали для измерения экспрессии специфических генов на уровне мРНК либо в HCEC, органоидах, либо в образцах легких. Тотальную РНК экстрагировали с использованием набора NucleoSpin® RNA II (MACHEREY-NAGEL, Дюрен, Германия) в нашей лаборатории.Обратную транскрипцию проводили с использованием набора для синтеза кДНК PrimeScript™ First Strand (Takara, Otsu, Japan) с 900 нг общей РНК с последующей ПЦР TaqMan в реальном времени с использованием системы ПЦР в реальном времени Applied Biosystems 7500 (Applied Biosystems, Foster City). . Последовательности праймеров и зондов генов-мишеней перечислены в дополнительной таблице S3, а B2M и ACTB использовались в качестве эталонных генов для образцов человека и мыши соответственно. Амплификацию устанавливали на 10 с при 95°С, после чего следовали 40 двухступенчатых циклов (15 с при 95°С и 1 мин при 60°С).После анализа с помощью прилагаемого системного программного обеспечения SDS (Applied Biosystems) получали Ct для каждой реакции. Для расчета относительного Ct по сравнению с B2M (ΔCt = Ct ген  - Ct B2M/ACTB ) использовали среднее значение трех повторов для каждого образца. Затем среднее значение ΔCt для трех образцов использовали для расчета ΔΔCt экспериментальных образцов по сравнению с контролем PBS (ΔΔCt = ΔCt FlgE  - ΔCt PBS ). Относительная экспрессия генов в образцах, обработанных FlgE/FlgEM, была рассчитана как 2 -ΔΔCt .

Pull-down анализы и подтверждение белков-кандидатов

Для идентификации потенциальных рецепторов или конъюгирующих молекул для FlgE использовали самодельную колонку для аффинной хроматографии. Вкратце, 500 мкг очищенного рекомбинантного FlgE смешивали с 100 мкл гранул His-агарозы (полученных из колонки His-Trap FF Crude) в буфере для связывания (20 мМ фосфата натрия, 500 мМ хлорида натрия, 30 мМ имидазола, pH 7,4). и инкубировали при 4 °C в течение 16 часов. Несвязанный FlgE удаляли 3-кратной промывкой PBS.Затем из ~10 8 HCEC были приготовлены суммарные мембранные белки с использованием набора для экстракции мембранных белков (Bestbio, Шанхай, Китай) и инкубированы с FlgE-насыщенной агарозой в 300 мкл PBS при 4°C в течение 8 ч с агитации около 20 об/мин. Одновременно в качестве отрицательного контроля проводили инкубацию мембранных белков со сбалансированными пустыми агарозными шариками. После пяти промывок PBS белки, связанные с агарозой, элюировали 100 мкл 0,2 М глицин-HCl.После немедленной нейтрализации 15 мкл 1 М трис-HCl, рН 9,1, элюат концентрировали до 20 мкл с использованием пробирки для ультрафильтрации (Millipore, Bedford, MA) и затем разделяли на 12% SDS-PAGE для разделения в геле в течение 30 мин. Гель окрашивали красителем Г-250. Шесть белковых полос из группы инкубации белков FlgE-мембраны со значительным отличием от контроля отбирали и вырезали, затем обесцвечивали 0,1% уксусной кислотой и подвергали расщеплению в геле трипсином. Полученные пептиды анализировали с помощью тандемной масс-спектрометрии с наножидкостной хроматографией с использованием масс-спектрометра nanoACQUITY UPLC и SYNAPT G2 HD (Waters Corporation, Милфорд, Массачусетс).Данные масс-спектрометрии были получены с использованием режима анализа, зависящего от данных, и обработаны с помощью программного обеспечения PLGS 2.4 (Waters), а полученный список пиков был найден в базе данных NCBInr Homo sapiens с использованием поисковой системы MASCOT (Matrix Science Inc., Бостон, Массачусетс). Эта программа устанавливает 38 как пороговое значение по умолчанию для возможных совпадений. Однако в этом исследовании белки считались потенциальными партнерами по связыванию FlgE, если хотя бы один пептид имел оценку, равную или превышающую произвольную оценку 114 (т.е., в три раза больше порогового значения по умолчанию, равного 38).

Для подтверждения истинного присутствия специфического белка, предполагаемого с помощью вышеупомянутой масс-спектрометрии, в данном случае CAV1, для извлеченных белков был использован вестерн-блоттинг. В то же время для оценки предполагаемой специфичности взаимодействия FlgE-CAV1 агарозу, конъюгированную с FlgEM, готовили точно так же, как с FlgE-агарозой, описанной выше. Для сравнения такое же количество мембранных белков HCEC инкубировали с FlgE или FlgEM-насыщенной агарозой, чтобы обеспечить связывание при 4 ° C в течение 8 часов.Гранулы промывали PBS, суспендировали в буфере для загрузки 1× SDS и кипятили в течение 10 мин. Гранулы центрифугировали, супернатанты подвергали SDS-PAGE и переносили на поливинилидендифторидную мембрану (Millipore, Billerica, MA). Мембраны блокировали 5% обезжиренным сухим молоком, растворенным в трис-буферном солевом растворе с твином-20 (TBST; 20 мМ трис, рН 7,5, 0,5 мМ NaCl, 0,05 % твин-20) в течение 1 ч, а затем инкубировали в течение ночи с антигеном. -CAV1-антитело (ab2910, Abcam, Кембриджский научный парк, Кембридж, Великобритания) и анти-His-антитело (Transgen Biotech, Пекин, Китай) при 4 °C.После промывки при перемешивании в течение 30 минут мембраны инкубировали с HRP-конъюгированным козьим антителом Affinipure против кроличьего IgG или против мышиного IgG (Cell Signal Technology, CA) при комнатной температуре в течение 1 часа. После тщательной промывки гибридизованные полосы обнаруживали с помощью набора Enhanced ChemiLuminescence Kit (Perkin-Elmer Life Sciences, Boston, MA) в соответствии с инструкциями производителя. Для контроля нагрузки использовали мышиное моноклональное антитело против GAPDH от Kangchen (Шанхай, Китай) и кроличье антитело против мышиного IgG от ZSGB-BIO Biosciences (Пекин, Китай).

Вестерн-блот органоидных тканей легких, обработанных FlgE

Для изучения возможных путей, затронутых стимуляцией FlgE, были приготовлены образцы белка из органоидов легких мышей дикого типа и CAV1 -/- , обработанных 5  мкг/мл FlgE в разное время.

Добавить комментарий

Ваш адрес email не будет опубликован.