Содержание

МДВ - это... Что такое МДВ?

  • МДВ — Медицина для вас (газета) механизм дальнего взведения …   Словарь сокращений русского языка

  • СПб-МДв — СПМД Санкт Петербургский монетный двор ранее: ЛМД http://www.mintspb.ru/​ Санкт Петербург СПб МДв Источник: http://ruscoins.narod.ru/bio ch sch.html …   Словарь сокращений и аббревиатур

  • Битвы Fantasy — Битвы Fantasy  самая масштабная и известная настольная игра от компании «Технолог». Наборы включают один или несколько отрядов, реально стреляющие оружия, которые нужно собрать самим. Иногда попадаются строительные наборы. Для игры… …   Википедия

  • FSO (технология) — У этого термина существуют и другие значения, см. FSO. FSO Free Space Optics (WO Wireless Optics, АОЛС Атмосферная Оптическая Линия Связи) вид оптической связи, использующий электромагнитные волны оптического диапазона (свет), передаваемые через… …   Википедия

  • СПМД — СПб МДв СПМД Санкт Петербургский монетный двор ранее: ЛМД http://www.mintspb.ru/​ Санкт Петербург СПб МДв Источник: http://ruscoins.narod.ru/bio ch sch.html СПМД Союз правой молодёжи Донбасса У …   Словарь сокращений и аббревиатур

  • Коронас-Фотон — Коронас Фотон …   Википедия

  • Баев, Олег Яковлевич — У этого термина существуют и другие значения, см. Баев. Баев, Олег Яковлевич Дата рождения: 28 июня 1941(1941 06 28) (71 год) Место рождения: Воронеж, РСФСР Страна …   Википедия

  • Коронас-фотон — КА «Коронас Фотон» Основные сведения: Дата и время запуска: 30 января 2009 года, 16:30 МДВ Платформа: Метеор М Заказчики: Федеральное кос …   Википедия

  • Олег Баев — Баев, Олег Яковлевич Дата рождения: 28 июня 1941 Место рождения: Воронеж, РСФСР Гражданство: СССР, РФ Научная сфера: Криминалистика Место …   Википедия

  • Олег Яковлевич Баев — Баев, Олег Яковлевич Дата рождения: 28 июня 1941 Место рождения: Воронеж, РСФСР Гражданство: СССР, РФ Научная сфера: Криминалистика Место …   Википедия

  • Мдф что это такое, расшифровка аббревиатуры

    Прогресс в технологии произвел рациональное применение отходов из любой древесины, именно таким образов появились плиты МДФ. Расшифровка указанного материала основывается на английских буквах MDF, согласно переводу это означает – древесноволокнистая плита средней полости. МДВ было изобретено как дальнейшее развитие сухого варианта производства ДВП, учитывая все совершенствования при изготовлении ДВП технологии. Часто, словосочетание МДФ применяются как альтернативное название всеми популярному названию ДВП. Если разобраться, то это в принципе является одним и тем же, отличие наблюдается лишь в технологии изготовления, которая дает материалу новейшие свойства указанного материала.

    Где применяется вышеуказанный материал

    МДФ считается хорошей альтернативой в большинстве случаев, когда необходим отделочный материал. Указанный строительный материал нашел широкое использование в многочисленных областях. Декоративные плиты могут использоваться для изготовления разнообразной мебели. Если коснутся автомобилестроения, то МДФ применяют для отделки деталей в салоне машины. Разнообразные строительные компании применяют МДФ при ремонте либо уже окончательной отделки стен напольного покрытия либо стен. Вышеуказанный вид материала полости может применять для изготовления разнообразной тары. Из описанного материала часто изготавливают великолепные двери либо наличники, а также стеновые преграды.

    Также МДФ часто используют в рекламном бизнесе, так как из него делают стенды для выставок. В электронной сфере материал используется для производства колонок либо иных акустических систем. МДФ считают декоративным материалом, который нашел использование в разнообразных отраслях. Вышеуказанный материал - это достойная замена древесине, и при этом ценовая политика значительно ниже. Древесноволокнистая плита средней полости никаким образом не уступает по качеству древесине, а по определенным показателям даже имеет преимущество.

    Технология изготовления вышеуказанного материала

    Изготовление материала осуществляется в пару действий. Для начала необходимо заготовить сырье, как правило, это обыкновенный лес. Все бревна необходимо хорошо очистить от коры, далее она измельчаются на маленькие щепки, соответственно получается состав, который необходимо избавить от мусора, песка и отправить пропарится. После того, как масса прошла пропарку, вся щепка измельчается, а дальше в нее помещаются специальные смолы. После полученная масса помещается в сушилку, далее из нее полностью убирают весь воздух. На специальном формировочном станке получают, определенное волокно. При помощи вышеуказанного станка массу начинают сдавливать в ковер, соответственно под влиянием давления устраняется воздух.

    Наиболее главным этапом изготовления плиты МДФ, считается прессовка. Данный процесс заключается в том, что древесноволокнистый ковер отправляют на окончательную прессовку, а после происходит его разрезание и охлаждение. Дабы придать внешне красивый вид, изготовленные панели отправляют на шлифовку, также происходит выравнивание толщины полотна, и удаление дефектов. Дабы получить именно плиты МДФ, используется технологическая щепка, парафин, аммоний хлористый и смола. Полученный материал необходимо сохранять исключительно в запечатанном виде. В месте, где хранится материал, влажность не должна быть больше 70%, а температура максимально достигает 25 С.

    Учитывая вариант отделки лицевой поверхности МДФ, их можно разделить по видам. Наиболее распространенные.

    • Ламинированные плиты. Изготавливаются при нанесении нанесения на поверхность специальной пленки ПВХ. Пленка достаточно эластична, пылеотталкивающая.
    • Шпонированные плиты. Изготавливаются при помощи облицовки шпонов ценных пород древесины, которому можно придать любой оттенок.
    • Крашенные панели. Для окрашивания, могут использоваться качественные составы, у которых высокая устойчивость к химическому влиянию.

    Состав указанного материала. Свойства

    МДФ имеет немного схожего состава с ДВП. Волокна хорошо высушенной древесины перемешиваются с разнообразными синтетическими веществами клеящего свойства. Сделанный состав прессуется при помощи влияния высокой температуры, а затее происходит шлифование. Именно данным способом изготавливается МДФ.
    Дабы склеить все частицы применяют специальные типы смол, какой, как правило, не имеют, свойства испарятся, после того, как пройдено прессование и термическая обработка. Наиболее основное положительное свойство МДФ заключается в том, что в него входит очень маленький процент содержания ядовитых формальдегидов. Именно благодаря данному факту, уровень экологической безопасности МДФ намного выше, нежели у его аналогов.

    Главные качества

    • Великолепная прочность. Именно благодаря данному факту, материал нашел широкое использование в мебельной сфере.
    • Устойчивость к воде. Водостойкость материала не сопоставима с таким материалом, как пластмасса, но она намного выше, нежели у натуральной древесины.
    • Обрабатываемость. МДФ великолепно можно резать, шлифовать и обрабатывать определенными инструментами. Данное свойство позволяет делать разнообразные фигуры на основе панелей древесноволокнистой плиты, соответственно открывается широкая возможность при дизайнерском оформлении.
    • Биологическая устойчивость. Наивысшая степень плотности, а также пропитка полимерным клеящим, не позволяет приспосабливаться к нему разнообразные микроорганизмы. Из этого следует, что гниение и грибок не возникают.

    Положительные характеристики и недостатки

    Существует множество положительных характеристик указанного материала.

    1. Основной положительной характеристикой является легкость монтажа. Перед тем как начинать обшивать стены, не стоит делать предварительную подготовку. Соответственно отпадает проблема дополнительной уборки комнаты от грязи и пыли. МДФ достаточно прочный и однородный строительный материал, это делает его наиболее устойчивым к влаге либо горячим парам.
    2. Ценовая политика не велика.
    3. МДФ – это экологически безопасный материал, который не наносит вреда здоровью человека. Более того, материал считается великолепным утеплителем и звукоизолятором.
    4. Древесноволокнистая плита средней полости способна сохранять длительное время геометрические параметры.
    5. Великолепное качество поверхности: структура гладкая, ровная, при всем этом, достаточно плотная. Любая необходимая обработка вышеуказанного материала не вызовет сложностей. Также радует цветовая палитра материала.
    6. МДФ не подвергает атакам разнообразных грибков и микроорганизмов.

    К определенным минусам вышеуказанного вида плиты можно отнести:

    • быстрая занимаемость если есть контакт с открытым пламенем;
    • не достаточно сильная устойчивость к механическим повреждениям.

    Количество недостатков не так велико, как перечень преимуществ материала. Необходимо отметить, что выбор отделочного материала – это личное дело каждого.

    • 0,1928 s
    • ©2021 Все права защищены

    расшифровка аббревиатуры в мебели, что это такое, материал ЛДСП, как расшифровывается MDF панель, ЛМДФ стройматериалы, состав

    Современные технологии позволяют производить различные по качеству и свойствам материалы. Мебель давно уже не производится из натурального дерева, на смену ему пришли различные заменители, выполненные из его стружек или вообще из картона. Как не ошибиться и выбрать качественный и недорогой материал среди всего этого разнообразия? Необходимо разобраться в составе и свойствах каждого из них. Начнем с расшифровки что такое МДФ, который присутствует почти в каждом доме.

    Расшифровка что такое МДФ (MDF)

    Заложенная в этой аббревиатуре расшифровка связана с англоязычным названием этого материала. Она звучит, как Medium Density Fiberboard (MDF) и первые заглавные буквы обозначены в названии МДФ. В переводе они обозначают мелкодисперсную фракцию.

    На самом деле он представляет собой древесно-волокнистую структуру, выполненную в виде плиты средней плотности, которую получают сухим прессованием. Для ее изготовления применяется заранее высушенная древесная стружка мелкой фракции. Она поступает в специальное устройство, где под воздействием высокого давления и температур выделяется лингин – природное связующее вещество, благодаря которому стружка скрепляется и получается достаточно прочный и долговечный материал на выходе. В отдельную категорию можно вынести плиты ХДФ.

    Важно знать: что лучше мдф или дсп для мебели.

    На видео –  расшифровка: что такое МДФ:

    В технологический процесс его производства можно заранее заложить определенные свойства. Поэтому так много вопросов, что такое фанера и подобные материалы. Например, влагостойкость, гибкость, высокую прочность или пожаробезопасность. Производители не только усовершенствовали процесс получения МДФ, но и вычислили оптимальные размеры для полотен, которые можно будет удобно использовать для разных целей. Они считаются экологичными и безопасными, поэтому широко применяются для внутренних отделок и создания мебели.

    Мдф или дсп: что лучше использовать при строительстве или ремонте можно узнать из статьи.

    Разновидности плит

    В зависимости от проведенной отделки поверхности плит их подразделяют на три пита:

    Ламинированные

    Такие плиты с лицевой стороны покрыты специальной пленкой ПВХ. Процесс ламинирования состоит из приклеивания пленки к древесной плите, которое происходит под давлением.

    В результате может получиться как глянцевая, так и матовая поверхность. Поверхность таких полотен может имитировать древесину. А если применяется цветное ламинирование, то это дает возможность подобрать абсолютно любой оттенок, что особенно важно при изготовлении фасадов мебели. К их главным качествам относятся:

    • прочность;
    • устойчивость к ультрафиолету и влаге;
    • гигиеничность;
    • стойкость к химическим моющим средствам;
    • грязеустойчивость.

    Информация о том, как плинтуса напольные широкие мдф наиболее эффективно использовать при ремонте можно из статьи.

    Шпонированные

    К одной или сразу к двум сторонам плит МДФ приклеивается шпон, изготовленный из ценных пород деревьев. Это не дешевый вид, поэтому применяется редко. После шпонирования полотна:

    • делаются влагоустойчивыми;
    • становятся устойчивыми к короблению;
    • не рассыхаются. 

    Под покраску

    Это цельно прессованные плиты, их поверхность может быть окрашена, чтобы защитить материал от внешних негативных воздействий. Красят полотна вручную или аппаратным методом. Крашеные полотна отличаются низкой стоимостью и таким же качеством материала. Узнать лдсп или мдф: что лучше использовать при ремонте можно из статьи.

    Применение материала

    По своим свойствам МДФ делится на следующие виды:

    Декоративные стеновые панели

    Их монтаж может производить любой человек за счет простоты исполнения таких плит и продуманности крепежа. Одна сторона каждого полотна имеет паз, а другая – гребень, и они образуют между собой замок. Если этот материал находится в особо ответственных местах, то можно дополнительно закрепить его строительными скобами или клеем. Всю информацию про стеновые панели мдф в Леруа Мерлен можно узнать из статьи.

    К плюсам таких панелей относится:

    • внешний вид;
    • экологичность;
    • простота монтажа;
    • высокая теплопроводность;
    • шумозащита.

    К минусам можно отнести:

    • быструю возгораемость;
    • подверженности механическим повреждениям.

    Такие полотна имеют характеристики соответствующие цене. Узнать про стеновые панели МДФ под кирпич можно из статьи.

    Влагостойкие панели

    Эти плиты универсальны. Они обладают высокой влагозащитой, поэтому при попадании на влагостойкие стеновые панели большого количества воды они не деформируются и не разрушаются, на них не образовывается плесень. Очень похожи по своим свойствам н пластик. 

    Кроме этого имеют еще ряд преимуществ:

    • высокий уровень шумоизоляции;
    • легкость в обработке;
    • прочность.

    Каковы размеры панелей МДФ можно узнать здесь, прочитав статью.

    Глянцевые полотна

    Они применяются при производстве мебели. Часто можно увидеть лицевую сторону шкафов, выполненную ими, реже из них делаются боковые стороны. За счет глянцевого слоя они могут подойти к любому интерьеру. При этом он защищает материал и продлевает срок службы. 

    Плиты обрабатывают следующими покрытиями:

    • праймером;
    • полиэстером.

    Узнать более подробно про стеновые панели из МДФ для внутренней отделки можно здесь из статьи.

    После применения первого покрытия панели становятся высоко глянцевыми (акриловыми). Это обеспечивает им улучшенный внешний вид и гарантирует высокие прочностные характеристики. После такой обработки поверхности она становится устойчива к влаге и царапинам.

    Главным недостатком всех вышеперечисленных панелей является их хрупкость при гибке, поэтому производители учли это и выпустили новый вид МДФ.

    Гибкие панели

    Они идеальны при создании арок и гнутых конструкций. Их используют в двух вариантах:

    • однослойном, который крепится к основанию клеем;
    • двухслойном. Эта разновидность способна соединяться между собой.

    Гибкие полотна имеют гладкую поверхность, к тому же ее можно красить, декорировать и шпонировать, то есть они могут дополнять выбранный основный вид панелей. 

    Кроношпан

    Его аббревиатура звучит, как ЛДСП. Это материал повышенной плотности подходит для укладки пола и декорирования стен. Имеет толщину – 10 мм, поэтому нашел свое применение в мебели для детских комнат. Так как отличается устойчивостью к механическим повреждениям и надежностью. Подробнее про размеры листа ЛДСП вы можете найти в статье.

    Узнать про панели МДФ для потолка можно здесь из статьи.

    Свойства и состав

    К основным достоинствам материала относятся:

    • Декоративность. Можно взять для отделки несколько видов МДФ и они будут прекрасно дополнять друг друга. Их внешние поверхности предоставляют возможность выполнять различные орнаменты и имитировать структуры природных материалов.
    • Прочность. Их можно надежно закреплять, по твердости плиты схожи с натуральной древесиной;
    • Долговечность. Полотна МДФ устойчивы к температурным перепадам. Они в процессе службы не коробятся и не растрескиваются. Благодаря особой технологии производства на них не появляется грибок. Такие панели не поддаются воздействию влаги, ультрафиолета и насекомых. При этом материал не требует особого ухода и дополнительной защиты.
    • Влагоустойчивость. Материал известен своей низкой гигроскопичностью, поэтому не поддается коррозии. Плотный однородный его состав позволяет использовать МДФ для кухонной мебели.
    • Экологичность. Производство плит такового, что основной материал и его связующее вещество носят природный характер. При эксплуатации он не выделяет опасных испарений и не токсичен.
    • Универсальность. Благодаря высоким показателям технологичности его можно применять в различных помещениях. Он может дополнить собой любой декор.
    • Легкость монтажа. Для его установки не нужны профессиональные навыки и особые инструменты.
    • Гигиеничность. За поверхностью материала просто ухаживать, у нее есть грязезащитная функция, поэтому частые протирания ни к чему.
    • Звукоизоляция. При декорировании такими панелями стен, остается воздушная прослойка, которая тормозит прохождение шума извне и препятствует уходу тепла из помещения.
    • Стоимость. В сравнении с природной древесиной цена материала отличается демократичностью.

    Более подробно про фартуки для кухни из МДФ можно узнать  здесь, прочитав статью.

    На видео рассказывается о составе  панелей МДФ:

    Где применяется

    Он считается наилучшей альтернативой многим отделочным материалам, поэтому нашел широкое применение во многих областях. Его декоративные плиты применяются для производства мебели, в особенности незабываемых фасадов шкафов в кухню, детскую, прихожую и залу. В сфере автомобилестроения им отделывают детали в салоне машин. Строительные компании используют МДФ при ремонте и финишной отделки полов и стен помещений. Его также применяют для изготовления различной тары. Из этого материала получаются отличные двери и наличники к ним, а также стеновые перегородки. А о том, что из себя представляет МДФ плинтус вы можете узнать из нашей статьи.

    МДФ применяется в рекламном бизнесе – из него выполняются выставочные стенды. В электронике он нашел применение при производстве колонок и других акустических систем.

    В рамках темы полезно почитать и о том, что такое ДВП.

    МДФ – декоративный материал, нашедший применение в различных отраслях. Он достойно заменяет древесину и при этом стоит в два раза дешевле ее. Он не уступает ей по качеству, а по некоторым характеристикам намного превышает показатели. Чтобы не запутаться в понятиях, стоит также выяснить ХДФ что это, и подходит ли он для ваших работ. Является оптимальным вариантом для тех, кто хочет провести ремонт или собрать мебель с использованием качественного материала, без непосильных затрат.

    ЛДСП или МДФ - какой материал лучше для мебели?

    Попросите специалиста назвать два самых популярных материала для изготовления мебели, и он уверенно назовет ЛДСП и МДФ. Они давно и успешно используются в качестве заменителей дерева.  Хотя технология их производства имеет сходные черты, свойства материалов различны. Если узнать эти различия, ответить на вопрос, какой из них лучше, будет просто. 

    ЛДСП — ламинированная древесно-стружечная плита. Ее основа — древесные стружки, прочно спрессованные и пропитанные формальдегидной смолой. Смола-добавка небезопасна, и существует два экологических стандарта — Е1 и Е2. Второй допускает больше вредных веществ, поэтому ЛДСП стандарта Е2 не используют для детских комнат и лечебных помещений. Поверхность плит покрывают ламинированной бумажной пленкой с добавкой меламиновой смолы, благодаря чему прочность материала увеличивается.

    МДФ — древесно-волокнистая плита. Изготавливают ее из древесных опилок, связующим для которых является лигнин или парафин. Такая плита безопасна в эксплуатации. Плита прочнее и устойчивее к высокой температуре и присутствию воды, чем ЛДСП, благодаря более мелким и однородным частицам.

    Свойства плит МДФ

    ·         безопасны;

    ·         устойчивы к воде и высоким температурам, механическим повреждениям;

    ·         мягкие, возможна тонкая обработка и отделка;

    ·         цена выше, чем ЛДСП;

    ·         отлично удерживают петли и другую фурнитуру;

    ·         разнообразнее в видах отделки — кроме гладкого цветного покрытия эмалью, пластиком, широко используются филенки, резьба, карнизы, пилястры;

    ·         практически обладают достоинствами натурального дерева (а стоят дешевле).

    Глядя на изящные изделия, выполненные в разных стилях, бывает трудно поверить, что они сделаны из МДФ. На вид они совсем неотличимы от мебели из натуральной древесины.

    Свойства плит ЛДСП

    ·         ограниченно безопасны;

    ·         устойчивы к температурным перепадам, влаге, механическому воздействию;

    ·         твердые, что исключает тонкую отделку;

    ·         более дешевые;

    ·         ограничены в отделке — покрытие ламинированной пленкой, хотя и с широкой гаммой цветов и фактур.

    Следует отметить, что в наиболее сложных условиях эксплуатации находится мебель для кухни и ванной комнаты, поэтому ей требуется уделить особенное внимание. Кроме температуры и влажности, случайных ударов, частого открывания дверец, она испытывает воздействие средств бытовой химии, кипящей воды и масел. Поэтому специалисты рекомендуют выбирать МДФ для такой мебели.

    Сравнивая свойства ЛДСП и МДФ, мы видим, что главное преимущество ЛДСП — привлекательная цена.  Нужна мебель эконом-класса по минимальной стоимости? Тогда ЛДСП — то, что нужно. Нужны красивые фасады с резьбой? Тонкой отделкой? Красивая, долговечная и безопасная мебель? Тогда  выбор за МДФ.


    Фрезеровка МДФ

    Нашей компанией предоставляется такая услуга, как фрезеровка МДФ, которая особенно активно применяется при изготовлении мебельных фасадов. Плита МДФ является продуктом, который завоевал огромную популярность на рынке новейших материалов. Великолепные эксплуатационные свойства, приближенность по экологичности и качеству к натуральной древесине и, в конце концов, возможность специальной обработки, а также тиснения поверхности делает этот вид продукции в виде плит особенно привлекательным в процессе производства мебели высокого качества.

    Здесь можно увидеть цветовую гамму матовых и глянцевых пленок, которыми покрываются фасады данного материала. Поэтому фрезеровка МДФ может совершаться различными способами, благодаря которым мы сможем воплотить в жизнь самые оригинальные предложения заказчика.

    Особенности технологии изготовления этого листового материала заключаются в том, что данное сырье изготовляется из высушенных волокон древесины, которые обработаны связующими веществами, сформированы в виде плиты с дальнейшим горячим прессованием.

    Следует особо отметить, что при изготовлении этого материала не используются вредные для здоровья и организма человека фенол и эпоксидные смолы. Именно по этой причине данный материал стали широко использовать при изготовлении мебели для кухни, поскольку они очень хорошо противостоят воздействию кухонного пара - не коробятся, не разбухают. А высокая прочность к механическим повреждениям дает возможность использовать их при производстве мебельных фасадов. Кроме того, многие специалисты склоняются к единому мнению, что этот листовой материал по механическим характеристикам и влагостойкости превосходят даже натуральную древесину. Еще его одной особенностью является устойчивость к различным микроорганизмам и грибкам, это делает изделия из МДФ безопасными и гигиеничными в быту.

    Фрезеровка МДФ – это обработка различных листовых материалов с помощью фрезы. Она совершает вращательное движение, а заготовка — в преимущественной степени поступательное движение, зачастую в направлении перпендикулярном оси движения фрезы. С помощью этой технологии на материале можно создавать необходимо объемное изображение, работу с которым упрощает специальное программное обеспечение и станок с чипом управления фрезой. Благодаря этому всему мы гарантируем высокое качество исполнению заказа любой сложности.

     

    Как крепить панели мдф к стене: пошаговая инструкция, свойства, виды

    При помощи МДФ-панелей для стен можно обновить интерьер в доме, сделать его современным и более выразительным. Внутренняя отделка стен этим материалом считается недорогим решением.

    Панелями можно облицевать потолок в квартире. Ниже расскажем, как своими руками закрепить панели МДФ, какие есть правила выбора и технические характеристики отделки.

    Что такое МДФ-панели

    Это отделочный материал из древесноволокнистых плит средней плотности. Делают их при помощи прессования мелких древесных фрагментов: стружки, щепы и опилок. Связующими элементами выступают смолы и меламин.

    Все составляющие обеспечивают малую эмиссию формальдегида – на уровне класса Е1. Если сравнивать этот показатель с ДСП, то там выделение вредных веществ может быть класса Е2-Е4.

    Схема изготовления строительного материала выполняется таким образом:

    1. Древесина в дефибраторе рассыпается на волокна при температуре 100ºС и уровне влажности 80%.
    2. В конце добавляют модификаторы и связующие смолы.
    3. Состав просушивается воздухом при температуре 240ºС.
    4. Сухую массу формуют ковром и прессуют.
    5. Изделие охлаждается и проходит шлифовку.

    Плотность стройматериала составляет 600-800 кг/м³, а толщина – от 2 до 40 мм. Плиты делают разной ширины и длины. На рынке товар представлен в разном цвете, есть фактурные поверхности под камень или дерево.

    Потолок и стены при отделке МДФ панелями лучше оформлять материалами, которые имитируют древесину ценных пород. Продукция имеет однородную структуру, хорошо поглощает звук, легко поддается обработке. При кройке образуется пыль, а не стружка, в отличие от ДСП-панелей.

    Совет! В процессе производства листов из МДФ можно придать материалу дополнительные свойства: огне-, водо- или биостойкость.

    Виды панелей

    В зависимости от оформления лицевой части есть несколько разновидностей стройматериала:

    • Ламинированные элементы. Благодаря большому выбору ПВХ-пленки для ламинирования, поверхность может быть с принтом, глянцевая, матовая, рельефная. Изделия получают дополнительную прочность и износостойкость. Это увеличивает срок службы отделочной полосы.
    • Окрашенные. Готовая продукция дополнительно покрывается краской.
    • Пробковые. Для обработки лицевой стороны берут тонкий слой пробки. Это дорогие изделия.
    • Шпонированные. Панели покрываются слоем шпона. Выглядят респектабельно и благородно в помещении. Срезы элементов МДФ-полос после крепления грунтуют, шлифуют и покрывают лаком. Это защищает дерево от влаги, УФ-лучей и механических повреждений.
    • Декоративные. Покрытие имитирует текстуру и цвет кирпича, кожи, кафеля или камня.

    Большой выбор стройматериала позволяет купить панели из МДФ в зависимости от стиля интерьера. Производители делают полоски длиной 250-270 см, а шириной от 15 до 90 см. Реже выпускают продукцию шириной до 120 см.

    Плюсы и минусы МДФ плит

    Декоративная отделка имеет достоинства:

    • Легкий монтаж. Крепить полосы можно в разных направлениях – поперек, вдоль основания, по диагонали. До монтажа не нужно тщательно выравнивать рабочую поверхность. Состояние стен не повлияет на качество работы.
    • Красивый вид. Большой выбор текстуры и цветов позволяет использовать МДФ для любого стиля. В процессе крепления панелей МДФ к стене появляется небольшое пространство. Его удобно использовать для сокрытия проводки и изоляции.
    • Простой уход. Очистить отделочный материал можно обычной губкой, смоченной в теплой воде. Если есть повреждения, сколы и трещины, то не нужно полностью менять обшивку. Достаточно снять дефектную плиту, а на ее место поставить новую.
    • Хорошая теплоизоляция. Материал отлично сохраняет тепло в помещении, поэтому не нужно покупать дополнительно утеплитель в квартиру.
    • Долгий срок службы. После монтажа МДФ панели прослужат не один десяток лет.
    Совет! Крепить плиты на стену можно в относительно сухих помещениях с благоприятными климатическими условиями. Предварительно нужно избавиться от потенциально опасных микроорганизмов.

    Несмотря на положительные качества, у МДФ-полос есть некоторые недостатки:

    • Малая влагоустойчивость. Под действием воды дерево деформируется. Поэтому в помещениях с высоким уровнем влажности следует монтировать специальные плиты с защитным слоем.
    • Образование полых стен. Полосы ставят на каркас, поэтому между обшивкой появляется пустота. При монтаже мебели следует использовать длинные дюбели и саморезы.
    • Риск возгорания отделки. Электрические провода, которые сокрыты за стеной, должны помещаться в огнестойкие короба.

    МДФ панель для стен быстро даст трещину при активном с ним контакте. Она неустойчивая к ударам и нагрузкам. Декоративные элементы нуждаются в правильном уходе и аккуратном монтаже.

    Варианты установки отделочного материала

    Монтаж панелей МДФ на стену в квартире своими руками может быть выполнен несколькими способами:

    1. Вагонкой, которая имитирует обшивку доской. Стыки легко защищаются при помощи соединения шип-паз. Технология укладки МДФ простая. За короткое время можно выполнить большой объем работ.
    2. Плиткой. Она имеет четкие размеры. Легко подсчитать нужное количество стройматериала.
    3. МДФ в виде листов. Продукция не имеет соединения шип-паз. Швы заделываются при помощи декоративных элементов. Плюс в использовании листов – создание целостного дизайна в помещении.

    В малогабаритных квартирах потолок рекомендуется обшивать полосами, если подобная отделка не использовалась на стенах. В противном случае помещение превратится в маленькую коробочку. Если стены сделаны под дерево, то листы на потолок лучше покупать светлых тонов.

    Обшивка потолка

    Панели МДФ на потолок используют в интерьере городских квартир и загородных домов. Если материал имеет влагостойкие функции, то его берут для отделки кухонных фартуков. Эко-материал подходит для спален и детских комнат, застекленных балконов и кабинетов.

    Монтаж делается аналогично отделке стен панелями МДФ. При этом не нужно забывать про технологические отверстия для прокладки освещения в комнате.

    Совет! Выполнять подготовительные работы нужно в том случае, если нужно «посадить» полосы на клей. Если выбрали вариант крепежа плит на обрешетку, можно не заниматься подготовкой поверхности.

    МДФ-панели в интерьере

    Отделочные пластины хорошо смотрятся в традиционных и современных направлениях и стилях:

    • Для деревенских стилей Кантри, Шале, Русской избы подойдут изделия в древесной палитре. Для Прованса, Марракеша лучше брать планки, окрашенные в пастельные тона.
    • Японский стиль. Можно выбрать неокрашенные элементы в виде плитки на стены и потолок.
    • Классика, Готика, Ампир или Модерн. Дизайнеры используют шпонированные детали на стены и потолок.
    • Фьюжн, эклектика. В этом случае на одну стену можно поклеить обои, а на другую – установить МДФ-плиту, окрашенную в яркие цвета.
    • Авангард, Техно или Индустриальный. Уместно использовать материалы, имитирующие текстуру камня, кирпича.

    При обшивке МДФ панелями цоколя стен отделка не должна быть выше 1/3 части основания. В противном случае можно визуально уменьшить потолок. Если комната имеет небольшой метраж, то не стоит полностью использовать дерево. В такой комнате проще крепить панели МДФ только на одну стену.

    Перечень инструментов для работы

    Для монтажа в интерьере МДФ панелей на стены не нужно закупать специфические инструменты. Подойдет стандартный набор, который используется для установки отделочных материалов.

    Подготовьте для работы:

    • Молоток.
    • Карандаш или маркер.
    • Отвес.
    • Электрический лобзик, пилку или ножовку по дереву.
    • Шуруповерт.
    • Рулетку.
    • Строительный степлер.
    • Гвозди, саморезы, дюбеля.
    • Металлические профили для каркаса.
    • Клей или жидкие гвозди.

    Чтобы подсчитать количество отделочного материала, сначала делают разметку.

    Совет! Предварительно удаляют со стен старую отделку. При необходимости проводят противогрибковую обработку, хорошо просушивают поверхность. Если неровностей много, то следует отштукатурить и загрунтовать основание.

    Подготовка поверхности и разметка

    Перед тем как использовать МДФ панели для отделки потолка или стен в помещении, необходимо выполнить ряд действий:

    1. Удалить старую отделку с поверхности.
    2. Если старая краска не удаляется со стен, то можно ее оставить. Она не будет мешать при дальнейшем монтаже.
    3. Уберите трещины, щели и зазоры при помощи грунтовки, цемента, штукатурки.
    4. Если на стенах остались значительные по размерам щели, то придется делать их шире, используя молоток и зубила. После поверхность обрабатывают грунтовкой, чтобы избежать появления микроорганизмов.
    5. Выбираем способ монтажа – на обрешетку, саморезы, клей.
    6. Выполняем точную разметку.
    7. Прислоняем строительный уровень к стене, чтобы определить нижнюю и верхнюю точку монтажа.
    8. Проводим горизонтальную линию по периметру помещения, где будут ставить панели. Такие же действия выполняются под потолком.
    9. Определяем расположение направляющих. Оптимальный шаг – 50 см.
    10. Если нужно утеплить конструкцию, то нужно наклеить пенофол или другую изоляцию.

    Дальнейшие действия с листами зависят от выбранного варианта крепления изделия к стене. Можно посадить МДФ-полосы на клей или использовать вспомогательный каркас, саморезы, кляймеры. Рассмотрим все варианты, чтобы понять специфику работу.

    Совет! Неровные стены требуют крепежа на обрешетку из металлического профиля или деревянных реек. В здании с кирпичными стенами или во влажных помещениях лучше не ставить деревянный каркас. Есть риск появления грибка, который со временем повредит обшивку.

    Способ № 1. Монтаж панелей с использованием каркаса

    Плюсы этого способа в том, что рейки ставят на основание любого типа без тщательной подготовки поверхности. Стены не нужно выравнивать, удалять старую краску и покрытие. Достаточно провести грунтовку, выполнить разводку проводки, вывести кабеля и нанести разметку.

    Когда нужно использовать обрешетку:

    • Если базовая поверхность имеет сильные неровности и выбоины, которые нельзя исправить вручную.
    • В помещениях с высокой влажностью. Тогда используют базу из металлического профиля.
    • При утеплении стен.

    Минусом этого варианта считается необходимость монтажа каркаса. Это сказывается на скорости ремонта. Дополнительно обрешетка скрадывает пару сантиметров свободного пространства.

    Устройство каркаса для МДФ панели

    Важно выбрать вариант крепления полос к стене – по вертикали или горизонтали. От этого зависит тип устройства обрешетки:

    • При горизонтальном расположении полос используется вертикальная схема каркаса.
    • При вертикальном положении листов – горизонтальная.

    Перед монтажом отделочных элементов нужно обработать рейки антисептиком. Это позволит защитить элементы от появления опасных микроорганизмов. Длина рейки должна быть на несколько миллиметров меньше фактического расстояния между нижней и верхней точками конструкции.

    Как закрепить панели МДФ с каркасом своими руками

    Последовательность работ следующая:

    1. Вне зависимости от вида каркаса (металлический или деревянный), придется зафиксировать угловые стойки. После закрепляют поперечные стойки и те, которые будут располагаться в проемах.
    2. Шаг в 50 см является оптимальным для всех материалов каркаса.
    3. Для фиксации широких и узких металлических профилей лучше брать саморезы. Гвозди-дюбели представляют менее надежный крепеж.

    Перед установкой каркаса проверяется ровность стены. Для этого используем гидроуровень или нитку с грузиком на конце (отвес). В местах изгибов ставят отметки карандашом или маркером. После в брусок или металлический профиль подкладывают куски фанеры, ДСП и других материалов для выравнивая основания.

    Совет! Под обрешетку можно настелить тонкий утеплитель, который крепится при помощи пластиковых дюбелей. Если нужно использовать минвату, то плиты просто вставляют между планками обрешетки.

    Как фиксировать панели на стене

    Когда обрешетка готова, то можно приступать к установке панелей. Для этого предварительно делаем замеры, отмеряем и нарезаем планки нужной длины. Далее срезаем гребень у первой панели и этой же стороной зажимаем к каркасу примыкающей стены. Крепление к горизонтальным полосам делается при помощи саморезов. Нужно отступить на 1 см от самого пола.

    Каждая плита вставляется аналогичным способом в паз предыдущей. После крепится кляймерами или гвоздями. Самый сложный этап – последний, когда нужно отрезать полосу нужной длины. Ее после фиксируют на вертикальной стойке обрешетки саморезами.

    Способ № 2. Монтаж при помощи клея

    Этот вариант крепления отделки используют в таких случаях:

    • Рабочая поверхность стены близка к идеальному состоянию.
    • В сухих помещениях.
    • Когда нужно сэкономить полезное пространство в доме.

    Подготовка и разметка поверхности для обшивки не отличаются от способа № 1. Разница в том, что нужно основательно нанести грунтовку, чтобы исключить образование опасных микроорганизмов.

    Процесс работы выглядит так:

    1. Обрезаем плиты при помощи электрического лобзика или ножовки на нужные фрагменты.
    2. Мажем клей по периметру и посредине полосы. Состав наносим крупными точками, а не сплошными линиями. Это поможет сэкономить потребление клея.
    3. Прижимаем панель к стене и фиксируем.

    Сначала клеят цельные листы. Угловые элементы и фрагменты – в конце монтажа. Полосу нужно прижать к основанию, простучать для плотного прилегания, а после – оторвать от стены.

    Нанесенный клей по дереву должен немного заветриться, чтобы потом лучше схватиться. Панель следует снова прижать к основанию, тщательно простучать, чтобы обеспечить качественную фиксацию.

    Способ № 3. Монтаж на саморезы и жидкие гвозди

    Панели без каркаса обычно крепят к поверхности при помощи саморезов. Такой вариант удобен, если основой выступает деревянная поверхность. В противном случае фурнитура со временем ослабеет, крепление не будет таким крепким. Полосы расшатаются и деформируются.

    Совет! В качестве клеевого состава для закрепления панелей МДФ можно использовать жидкие гвозди. Их особенности − низкая цена, надежность, быстрый монтаж.

    Прикрепление листов на жидкие гвозди проходит так же, как и при креплении на монтажный клей. Но есть свои нюансы. Не нужно ждать некоторое время для фиксации клея на плиты, в противном случае сцепление с поверхностью уменьшится. Излишки жидких гвоздей нужно вытирать вовремя, иначе внешний вид листа испортится.

    Способ № 4. Монтаж при помощи кляймеров

    Фурнитуру используют для отделки стен МДФ панелями при помощи каркаса из металла. Скобы прикрепляют к обрешетке саморезами.

    Работа ведется таким образом:

    • Выполняют замеры. По разметке обрезают первую полосу.
    • В ней делают дыры для коммуникаций (при необходимости).
    • Панель прикладывают в угол. Часть полосы закручивают саморезами, а другую крепят на клипсы.
    • Последующие части панелей устанавливают на стену при помощи замков и кляймеров.
    • Прикрепляют на клей плинтус на пол и потолок.
    • Фиксируют разрезной уголок на клей по всей длине элемента. Он должен прикрывать саморезы в углу. Подбирайте деталь в тон отделке.
    • В конце работы полосы протирают влажной губкой для удаления пыли и грязи. Можно использовать мыльный раствор.

    Монтировать древесноволокнистые элементы можно и на монтажную пену. Такой вариант лучше использовать в помещениях с повышенным уровнем влаги. Для этого берут специальный строительный пистолет. Процесс установки проходит так же, как и при приклеивании декоративного материала на клей или жидкие гвозди.

    Информация о том, как нужно крепить МДФ панели на стены позволит выполнить работу самостоятельно в домашних условиях. Материал достаточно легкий, удобный для использования, потому с креплением листов можно справиться в одиночку.

    Если выбран монтаж с каркасом, то важно правильно рассчитать количество материала и крепежных деталей. Желательно предварительно нарисовать подробную схему на основании, проставив все размеры. Если используете услуги сторонних организациях, то сможете проконтролировать работу мастера.

    Mdv MDSA-24HRN1/MDOA-24HN1 Настенная сплит-система

    Описание товара

      Mdv MDSA-24HRN1/MDOA-24HN1 Настенная сплит-система
     Неинверторные настенные кондиционеры MDV серии Aurora White – это современные и надежные сплит-системы, собравшие в стильном корпусе все новейшие технологии для контроля над климатом. Сплит-системы серии Aurora White поставляется с дизайнерской лицевой панелью серебристого цвета.
     Сплит-система MDV серии Aurora может эксплуатироваться в условиях нестабильных электрических сетей, что подтверждено тестовыми испытаниями в лабораториях производителя, сертифицированных независимой международной организацией TUV.

     Преимущества и особенности:


    Функция температурной компенсации

    При активации функции температурной компенсации автоматически учитывается разница температур в нижней части помещения (на уровне пола) и в верхней части (на уровне потолка), и создается заданная с пульта управления температура именно в нижней части помещения.

    Противопылевой фильтр высокой плотности

    Высокоэффективный противопылевой фильтр, обладающий более плотной структурой в сравнении с обычным фильтром, – первая ступень очистки. Он не только очищает проходящий через него воздух, но и защищает внутренний блок кондиционера от частиц пыли.

    Количество отверстий на 1 см2 – 225 (для сравнения, у обычного противопылевого фильтра всего 156).

    Фильтр тонкой очистки

    Фотокаталитический фильтр с диоксидом титана (TiO2) восстанавливает свои свойства под воздействием прямых солнечных лучей, поэтому не требует замены.

     

    Wi-fi управление (опция)

    С помощью wi-fi модуля можно управлять кондиционером через удобное приложение с вашего смартфона или планшета: включать и выключать, изменять настройки, запускать функции и т.д. 

    Функция обнаружения утечки хладагента

    При обнаружении утечки хладагента сплит-система останавливает свою работу с выдачей ошибки. 

    Два варианта присоединения дренажного трубопровода

    В сплит-системах Forest предусмотрено два варианта присоединения дренажного трубопровода. Для удобства переключения дренажный шланг оснащен быстросъемным механизмом. 

    Проводной пульт управления

    К сплит-системе серии Forest можно подключать опциональный проводной пульт управления.

    Компрессор GMCC (Guangdong Midea-Toshiba Compressor Corporation) – японские технологии для надежной и стабильной работы кондиционера.

    GMCC – совместное предприятие производителя кондиционеров MDV и корпорации Toshiba.

    Антикоррозийное покрытие теплообменника «Blue fin»

    Применение покрытия Blue fin улучшает эффективность теплообмена, а также увеличивает срок эксплуатации кондиционера.

     

    Гарантия

    Гарантийный срок Cплит-системы настенного типа Mdv 3 года.
     

    MDV

    MDV

    Мы обнаружили, что вы используете Internet Explorer (IE). Некоторые функции mdvnf.com будут недоступны вам, пока вы используют IE. Пожалуйста, подумайте об использовании Google Chrome или Microsoft Edge. Икс

    Сообщение о коронавирусе COVID-19

    Руководство MDV SpartanNash опубликовало публичное заявление относительно коронавируса (COVID-19), от которого страдают все мы здесь, в MDV, и наши уважаемые партнеры и клиенты.
    Щелкните ЗДЕСЬ, чтобы прочитать полное уведомление.

    Наше видение, миссия и культура

    Видение
    MDV - главный дистрибьютор бакалейных товаров Америки в вооруженных силах США, обеспечивая высочайший уровень производительности для сообщества вооруженных сил.
    Миссия
    Мы существуем, чтобы служить нашим героям вооруженной службы и их семьям, как дома, так и за рубежом.
    Культура
    Мы целеустремленная, командная организация, уважающая индивидуальность, честность, поощряет инновации и празднует успех.

    Основные ценности

    Ориентация на клиента
    Мы верим в то, что «клиент прежде всего», мы предвидим потребности и превосходим ожидания во всех взаимодействиях, как внутренних, так и внешних.
    Инновации
    Мы заставляем себя и друг друга бросать вызов условностям и превращать проблемы в возможности.
    Патриотизм
    Мы глубоко заботимся о тех, кто защищает нашу свободу и защищает наши семьи.
    Работа в команде
    Мы лучше решаем проблемы вместе, с более сильным мышлением и более творческими подходами.
    Респект
    Мы считаем, что признание талантов друг друга и разносторонних взглядов способствует созданию справедливой и всеобъемлющей атмосферы для роста и успеха.
    Целостность
    Мы честны и открыты друг с другом и со всеми заинтересованными сторонами.
    Подотчетность
    Мы действуем ответственно и ответственно, каждый раз выполняя взятые на себя обязательства.
    Праздник и веселье
    Мы уделяем время празднованию коллективных и индивидуальных достижений, привнося в нашу работу удовольствие.

    Болезнь Марека, герпесвирус, MDV | Окружающая среда, здоровье и безопасность

    Распечатай эту страницу

    ПАСПОРТ БЕЗОПАСНОСТИ МАТЕРИАЛА - ИНФЕКЦИОННЫЕ ВЕЩЕСТВА

    РАЗДЕЛ I: ИНФЕКЦИОННЫЙ АГЕНТ

    Название: Вирус герпеса болезни Марека (MDV), серотип 1.

    Синоним или перекрестная ссылка: Галлидный герпесвирус 2.

    Характеристики: Семейство herpesviridae, подсемейство alphaherpesvirinae, род Mardivirus Размер вириона с оболочкой составляет приблизительно 160 нм. Геном двухцепочечной ДНК размером примерно 180 т.п.н. Вирус реплицируется в лимфоцитах и ​​эпителиальных клетках in vivo. Вирус или вирус, культивируемый клетками в лимфобластоидных клетках, трансформированных MDV, строго ассоциирован с клетками. Уничтожение инфицированных клеток разрушает инфекционность. ДР.ГРУППА ЩАТА.

    РАЗДЕЛ II - ОПАСНОСТЬ ДЛЯ ЗДОРОВЬЯ

    Патогенность: Заражает кур, может заразить индюшат и японских перепелов. Инфекция вызывает разрушение лимфоцитов с последующей иммуносупрессией. При определенных условиях MDV вызывает лимфомы у кур, индеек и японских перепелов. Не заразно для человека.

    Эпидемиология: MDV имеет всемирное распространение.

    Ареал хозяев: Галловые птицы (куры, индейки, японские перепела)

    Инфекционная доза: Теоретически 1 единица образования налета может вызвать инфекцию у восприимчивых цыплят

    Путь передачи: Бесклеточный MDV продуцируется в эпителии перьевых фолликулов (ЭПФ), поэтому пыль и перхоть от перьев могут быть заразными.

    Инкубационный период: от 3 до 4 дней для репликации вируса в лимфоидных органах, от 12 до 16 дней для распространения вируса через FFE и> 3 недель для развития опухоли у кур.

    РАЗДЕЛ III - РАСПРОСТРАНЕНИЕ

    Водохранилище: Цыплята

    Зооноз: нет

    Векторы: нет

    РАЗДЕЛ IV - ЖИЗНЬ

    Чувствительность к лекарствам: N / A

    Восприимчивость к дезинфицирующим средствам: MDV, ассоциированный с клетками, чувствителен ко многим дезинфицирующим средствам. Рекомендуется 10 минут в 1% гипохлорите.

    Физическая инактивация: ассоциированный с клеткой вирус: 30 минут при 56 ° C. Бесклеточный вирус: 10 минут 1% гипохлорит, 30 минут при 56 ° C.

    Выживание вне хозяина: ассоциированный с клеткой вирус зависит от жизнеспособности клеток. Бесклеточный вирус из FFE, связанный с клеточными остатками: от 4 до 8 месяцев при комнатной температуре.

    РАЗДЕЛ V- МЕДИЦИНСКИЙ

    NA, не заразен для человека.

    РАЗДЕЛ VI - ЛАБОРАТОРНЫЕ ОПАСНОСТИ

    Лабораторные инфекции: лабораторных инфекций у человека не зарегистрировано.

    РАЗДЕЛ VII - РЕКОМЕНДУЕМЫЕ МЕРЫ ПРЕДОСТОРОЖНОСТИ

    Требования к локализации: Вирус, связанный с клетками: уровень биобезопасности 1 будет удовлетворительным, но уровень 2 будет необходим для предотвращения бактериального заражения культур клеток.

    Защитная одежда: Рекомендуется лабораторный халат

    Другие меры предосторожности: Нет

    РАЗДЕЛ VIII - ОБРАЩЕНИЕ С ИНФОРМАЦИЕЙ

    Разливы: Вирус, связанный с клетками: залить 1% гипохлоритом или 70% спиртом и очистить бумажными полотенцами.

    Удаление: Вирус, связанный с клетками: добавить 1% гипохлорита в суспензию инфицированных вирусом клеток или автоклав.

    Хранение: В криогенных флаконах в жидком азоте (предпочтительнее для длительного хранения) или при -80 ° C до 1 месяца.

    РАЗДЕЛ IX - РАЗНАЯ ИНФОРМАЦИЯ

    Дата подготовки: май 2005 г.

    Подготовил: К.А. Щат, профессор птичьей вирусологии

    Информация основана на главе «Болезнь Марека», написанной Виттером Р.Л. и Шатом К.А. в книге «Болезни домашней птицы» (учебник по болезням домашней птицы), 11-е издание, 2003 г.

    Болезнь Марека у кур: обзор с акцентом на иммунологию | Ветеринарные исследования

  • 1.

    Морроу К., Фелер Ф. (2004) Болезнь Марека: развивающаяся проблема. В: Дэвисон Ф., Наир В. (ред.) Болезнь Марека: всемирная проблема. Elsevier Academic Press, Лондон, стр. 49–61

    Chapter Google Scholar

  • 2.

    Химено И.М., Виттер Р.Л., Рид В.М. (1999) Четыре различных неврологических синдрома при болезни Марека: влияние вирусного штамма и патотипа.Avian Dis 43: 721–737

    CAS PubMed Статья Google Scholar

  • 3.

    Виттер Р.Л., Соломон Дж.Дж. (1972) Экспериментальное заражение индеек и кур вирусом герпеса индеек (HVT). Avian Dis 16: 34–44

    CAS PubMed Статья Google Scholar

  • 4.

    Afonso CL, Tulman ER, Lu Z, Zsak L, Rock DL, Kutish GF (2001) Геном вируса герпеса индейки.J Virol 75: 971–978

    CAS PubMed PubMed Central Статья Google Scholar

  • 5.

    Дэвидсон Ф. (2004) Болезнь Марека: развивающаяся проблема. Elsevier Academic Press, Лондон

    Google Scholar

  • 6.

    Gimeno IM, Cortes AL, Montiel ER, Lemiere S, Pandiri AK (2011) Влияние разбавления вакцин против болезни Марека на результаты инфицирования вирусом болезни Марека при заражении высоковирулентными вирусами болезни Марека.Avian Dis 55: 263–272

    PubMed Статья Google Scholar

  • 7.

    Дэвисон Ф., Наир В. (2005) Использование вакцин против болезни Марека: могут ли они привести вирус к увеличению вирулентности? Expert Rev Vaccines 4: 77–88

    PubMed Статья Google Scholar

  • 8.

    Химено И.М., Кортес А.Л., Сильва РФ (2008) Загрузка ДНК вируса болезни Марека в кровь как критерий ранней диагностики опухолей при болезни Марека.Avian Dis 52: 203–208

    PubMed Статья Google Scholar

  • 9.

    Рид А.Ф., Байгент С.Дж., Пауэрс С., Кгосана Л. PLoS Biol 13: e1002198

    PubMed PubMed Central Статья CAS Google Scholar

  • 10.

    Зербони Л., Сен Н., Оливер С.Л., Арвин А.М. (2014) Молекулярные механизмы патогенеза вируса ветряной оспы. Nat Rev Microbiol 12: 197–210

    CAS PubMed PubMed Central Статья Google Scholar

  • 11.

    Назериан К., Виттер Р.Л. (1970) Бесклеточная передача и репликация вируса болезни Марека in vivo. J Virol 5: 388–397

    CAS PubMed PubMed Central Google Scholar

  • 12.

    Abdul-Careem MF, Javaheri-Vayeghan A, Shanmuganathan S, Haghighi HR, Read LR, Haq K, Hunter DB, Schat KA, Heidari M, Sharif S (2009) Создание модели заражения вирусом болезни Марека на основе аэрозолей. Avian Dis 53: 387–391

    PubMed Статья Google Scholar

  • 13.

    Абдул-Карим М.Ф., Рид Л.Р., Парвизи П., Тантридж-Дон Н., Шариф С. (2009) Вызванная вирусом болезни Марека экспрессия генов цитокинов в перьях генетически определенных кур.Dev Comp Immunol 33: 618–623

    CAS PubMed Статья Google Scholar

  • 14.

    Калнек Б.В. (1986) Болезнь Марека - модель для онкологии герпесвируса. Crit Rev Microbiol 12: 293–320

    CAS PubMed Статья Google Scholar

  • 15.

    Calnek BW (2001) Патогенез заражения вирусом болезни Марека. Curr Top Microbiol Immunol 255: 25–55

    CAS PubMed Google Scholar

  • 16.

    St Hill CA, Silva RF, Sharma JM (2004) Обнаружение и локализация птичьих альфа-герпесвирусов в эмбриональных тканях после воздействия in ovo. Virus Res 100: 243–248

    CAS PubMed Статья Google Scholar

  • 17.

    Abdul-Careem MF, Haq K, Shanmuganathan S, Read LR, Schat KA, Heidari M, Sharif S (2009) Индукция врожденных реакций хозяина в легких цыплят после заражения очень вирулентным штаммом Marek's вирус болезни.Вирусология 393: 250–257

    CAS PubMed Статья Google Scholar

  • 18.

    Purchase HG (1970) Вирус-специфические иммунофлуоресцентные антигены и антигены преципитина и бесклеточный вирус в тканях птиц, инфицированных болезнью Марека. Cancer Res 30: 1898–1908

    CAS PubMed Google Scholar

  • 19.

    Butter C, Staines K, Baaten B, Smith L, Davison TF (2007) Путь заражения имеет решающее значение для определения клинического исхода инфекции очень вирулентным онкогенным вирусом герпеса, вирусом болезни Марека.Авиан Патол 36: 93–99

    CAS PubMed Статья Google Scholar

  • 20.

    Барроу А.Д., Берджесс С.К., Бейджент С.Дж., Хоус К., Наир В.К. (2003) Инфекция макрофагов лимфотропным вирусом герпеса: новый тропизм для вируса болезни Марека. J Gen Virol 84: 2635–2645

    CAS PubMed Статья Google Scholar

  • 21.

    Виттер Р.Л., Калнек Б.В., Бускаглия С., Гимено И.М., Шат К.А. (2005) Классификация вирусов болезни Марека по патотипу: философия и методология.Авиан Патол 34: 75–90

    CAS PubMed Статья Google Scholar

  • 22.

    Engel AT, Selvaraj RK, Kamil JP, Osterrieder N, Kaufer BB (2012) Вирусный интерлейкин-8 болезни Марека способствует образованию лимфомы за счет целевого рекрутирования В-клеток и CD4 + CD25 + Т-клеток. J Virol 86: 8536–8545

    CAS PubMed PubMed Central Статья Google Scholar

  • 23.

    Parcells MS, Lin SF, Dienglewicz RL, Majerciak V, Robinson DR, Chen HC, Wu Z, Dubyak GR, Brunovskis P, Hunt HD, Lee LF, Kung HJ (2001) Вирус болезни Марека (MDV) кодирует интерлейкин-8 гомолог (vIL-8): характеристика белка vIL-8 и мутантного MDV с делецией vIL-8. J Virol 75: 5159–5173

    CAS PubMed PubMed Central Статья Google Scholar

  • 24.

    Gesser B, Lund M, Lohse N, Vestergaad C, Matsushima K, Sindet-Pedersen S, Jensen SL, Thestrup-Pedersen K, Larsen CG (1996) IL-8 индуцирует хемотаксис Т-клеток, подавляет IL- 4, и регулирует выработку IL-8 CD4 + Т-клетками.J Leukoc Biol 59: 407–411

    CAS PubMed Google Scholar

  • 25.

    Баатен Б.Дж., Стейнс К.А., Смит Л.П., Скиннер Х., Дэвисон Т.Ф., Баттер С. (2009) Ранняя репликация в легочных В-клетках после заражения вирусом герпеса болезни Марека респираторным путем. Viral Immunol 22: 431–444

    CAS PubMed Статья Google Scholar

  • 26.

    Омар А.Р., Шат К.А. (1996) специфические клеточно-опосредованные клеточно-опосредованные иммунные ответы против немедленных ранних, поздних и уникальных белков MDV вируса сингенной болезни Марека (MDV).Вирусология 222: 87–99

    CAS PubMed Статья Google Scholar

  • 27.

    Омар А.Р., Шат К.А. (1997) Характеристика герпесвирус-специфических цитотоксических Т-лимфоцитов болезни Марека у цыплят, инокулированных неонкогенным вакцинным штаммом MDV. Иммунология 90: 579–585

    CAS PubMed PubMed Central Статья Google Scholar

  • 28.

    Reddy SM, Lupiani B, Gimeno IM, Silva RF, Lee LF, Witter RL (2002) Спасение патогенного вируса болезни Марека с перекрывающимися космидными ДНК: использование мутанта pp38 для проверки технологии исследования функции гена.Proc Natl Acad Sci USA 99: 7054–7059

    CAS PubMed PubMed Central Статья Google Scholar

  • 29.

    Lee LF, Cui X, Cui Z, Gimeno I, Lupiani B, Reddy SM (2005) Характеристика очень вирулентного мутанта вируса болезни Марека, экспрессирующего белок pp38 из вакцинного штамма серотипа 1 CVI988 / Rispens. Гены вирусов 31: 73–80

    CAS PubMed Статья Google Scholar

  • 30.

    Gimeno IM, Witter RL, Hunt HD, Reddy SM, Lee LF, Silva RF (2005) Ген pp38 вируса болезни Марека (MDV) необходим для цитолитической инфекции В-клеток и поддержания трансформированного состояния, но не для цитолитической инфекции. эпителия перьевого фолликула и горизонтального распространения MDV. J Virol 79: 4545–4549

    CAS PubMed PubMed Central Статья Google Scholar

  • 31.

    Биггс П.М., Наир В. (2012) Долгосрочная перспектива: 40 лет исследований болезни Марека и патологии птиц.Авиан Патол 41: 3–9

    PubMed Статья Google Scholar

  • 32.

    Morissette G, Flamand L (2010) Герпесвирусы и хромосомная интеграция. J Virol 84: 12100–12109

    CAS PubMed PubMed Central Статья Google Scholar

  • 33.

    Robinson CM, Cheng HH, Delany ME (2014) Временная кинетика герпесвируса болезни Марека: интеграция происходит сразу после инфицирования как в B-, так и в T-клетках.Cytogenet Genome Res 144: 142–154

    CAS PubMed Статья Google Scholar

  • 34.

    Delecluse HJ, Hammerschmidt W (1993) Статус вируса болезни Марека в установленных клеточных линиях лимфомы: интеграция вируса герпеса является обычным явлением. J Virol 67: 82–92

    CAS PubMed PubMed Central Google Scholar

  • 35.

    Lupiani B, Lee LF, Cui X, Gimeno I, Anderson A, Morgan RW, Silva RF, Witter RL, Kung HJ, Reddy SM (2004) Ген Meq, кодируемый вирусом болезни Марека, участвует в трансформации лимфоцитов, но не требуется для репликации.Proc Natl Acad Sci USA 101: 11815–11820

    CAS PubMed PubMed Central Статья Google Scholar

  • 36.

    Хак К., Шат К.А., Шариф С. (2013) Иммунитет к болезни Марека: где мы сейчас? Dev Comp Immunol 41: 439–446

    CAS PubMed Статья Google Scholar

  • 37.

    Mwangi WN, Smith LP, Baigent SJ, Beal RK, Nair V, Smith AL (2011) Клональная структура быстро возникающих MDV-управляемых лимфом CD4 + и отвечающих CD8 + Т-клеток.PLoS Pathog 7: e1001337

    CAS PubMed PubMed Central Статья Google Scholar

  • 38.

    Remy S, Blondeau C, Le Vern Y, Lemesle M, Vautherot JF, Denesvre C (2013) Флуоресцентное мечение VP22 на N-конце показывает, что VP22 способствует вирулентности вируса болезни Марека (MDV) у кур и позволяет изучение морфогенеза опухолевых клеток МД. Vet Res 44: 125

    PubMed PubMed Central Статья CAS Google Scholar

  • 39.

    Jarosinski KW, Arndt S, Kaufer BB, Osterrieder N (2012) Флуоресцентно помеченный pUL47 вируса болезни Марека показывает дифференциальную тканевую экспрессию белка тегумента in vivo. J Virol 86: 2428–2436

    CAS PubMed PubMed Central Статья Google Scholar

  • 40.

    Абдул-Карим М.Ф., Хантер Б.Д., Сарсон А.Дж., Парвизи П., Хагиги Х.Р., Рид Л., Хейдари М., Шариф С. (2008). Ответы хозяина индуцируются в перьях цыплят, инфицированных вирусом болезни Марека.Вирусология 370: 323–332

    CAS PubMed Статья Google Scholar

  • 41.

    Абдул-Карим М.Ф., Хантер Д.Б., Шанмуганатан С., Хагиги Х.Р., Рид Л., Хейдари М., Шариф С. (2008) Клеточные и цитокиновые реакции в перьях цыплят, вакцинированных против болезни Марека. Vet Immunol Immunopathol 126: 362–366

    CAS PubMed Статья Google Scholar

  • 42.

    Ахмед М., Шидловский Г. (1968) Электронно-микроскопическая локализация частиц герпесвирусного типа при болезни Марека.J Virol 2: 1443–1457

    CAS PubMed PubMed Central Google Scholar

  • 43.

    Черчилль А.Е., Биггс П.М. (1967) Возбудитель болезни Марека в культуре тканей. Nature 215: 528–530

    CAS PubMed Статья Google Scholar

  • 44.

    Harmache A (2014) Вирулентный биолюминесцентный и флуоресцентный двойной репортерный вирус болезни Марека открывает альтернативный путь распространения в дополнение к межклеточному контакту.J Virol 88: 11617–11623

    PubMed PubMed Central Статья CAS Google Scholar

  • 45.

    Heidari M, Fitzgerald SD, Zhang HM, Silva RF, Lee LF, Dunn JR (2007) Лейкоз кожи, вызванный вирусом болезни Марека, у цыплят без чешуи: развитие опухоли в отсутствие фолликулов пера. Avian Dis 51: 713–718

    CAS PubMed Статья Google Scholar

  • 46.

    Couteaudier M, Denesvre C (2014) Вирус болезни Марека и взаимодействия с кожей. Vet Res 45:36

    PubMed PubMed Central Статья Google Scholar

  • 47.

    Burgess SC, Young JR, Baaten BJ, Hunt L, Ross LN, Parcells MS, Kumar PM, Tregaskes CA, Lee LF, Davison TF (2004) Болезнь Марека - естественная модель лимфом, сверхэкспрессирующая антиген болезни Ходжкина. (CD30). Proc Natl Acad Sci USA 101: 13879–13884

    CAS PubMed PubMed Central Статья Google Scholar

  • 48.

    Murata S, Hayashi Y, Kato A, Isezaki M, Takasaki S, Onuma M, Osa Y, Asakawa M, Konnai S, Ohashi K (2012) Эпиднадзор за вирусом болезни Марека у перелетных и оседлых птиц на Хоккайдо, Япония. Vet J 192: 538–540

    PubMed Статья Google Scholar

  • 49.

    Haesendonck R, Garmyn A, Dorrestein GM, Hellebuyck T, Antonissen G, Pasmans F, Ducatelle R, Martel A (2015) Связанная с вирусом болезни Марека глазная лимфома у куропаток Рулруа ( Rollulus rouloul ).Авиан Патол 44: 347–351

    CAS PubMed Статья Google Scholar

  • 50.

    Миллер Д.М., Седмак Д.Д. (1999) Вирусные эффекты на процессинг антигена. Curr Opin Immunol 11: 94–99

    CAS PubMed Статья Google Scholar

  • 51.

    Hunt HD, Lupiani B, Miller MM, Gimeno I, Lee LF, Parcells MS (2001) Вирус болезни Марека подавляет поверхностную экспрессию гликопротеинов MHC (B Complex) класса I (BF) во время активности, но не скрытое инфицирование куриных клеток.Вирусология 282: 198–205

    CAS PubMed Статья Google Scholar

  • 52.

    Hearn C, Preeyanon L, Hunt HD, York IA (2015) Ген уклонения от иммунитета класса I MHC вируса болезни Марека. Вирусология 475: 88–95

    CAS PubMed Статья Google Scholar

  • 53.

    Jarosinski KW, Hunt HD, Osterrieder N (2010) Снижение регуляции MHC класса I вирусом болезни Марека (MDV) UL49.5 генный продукт слабо влияет на вирулентность гаплотип-специфическим образом. Вирусология 405: 457–463

    CAS PubMed Статья Google Scholar

  • 54.

    Niikura M, Kim T, Hunt HD, Burnside J, Morgan RW, Dodgson JB, Cheng HH (2007) Вирус болезни Марека активирует экспрессию на поверхности клеток класса II главного комплекса гистосовместимости класса II в инфицированных клетках. Вирусология 359: 212–219

    CAS PubMed Статья Google Scholar

  • 55.

    Gimeno IM, Witter RL, Hunt HD, Lee LF, Reddy SM, Neumann U (2001) Инфекция вируса болезни Марека в головном мозге: репликация вируса, клеточная инфильтрация и экспрессия антигена главного комплекса гистосовместимости. Vet Pathol 38: 491–503

    CAS PubMed Статья Google Scholar

  • 56.

    Стеванович С., ван Берген, Калифорния, ван Люксембург-Хейз С.А., ван дер Зоувен Б., Джорданова Е.С., Круиссельбринк А.Б., ван де Меент М., Харскэмп Дж.С., Клаас Ф.Х., Марийт Э. Jedema I, Griffioen M, Falkenburg JH (2013) Активация HLA класса II во время вирусной инфекции приводит к HLA-DP-направленной реакции трансплантат против хозяина после инфузии CD4 + донорских лимфоцитов.Кровь 122: 1963–1973

    CAS PubMed Статья Google Scholar

  • 57.

    Kimmel PL, Cohen DJ, Abraham AA, Bodi I, Schwartz AM, Phillips TM (2003) Повышенная регуляция экспрессии белков рецепторов MHC класса II, интерферона-альфа и гамма-интерферона при ВИЧ-ассоциированной нефропатии. Трансплантат Nephrol Dial 18: 285–292

    CAS PubMed Статья Google Scholar

  • 58.

    Cui X, Lee LF, Reed WM, Kung HJ, Reddy SM (2004) Ген vIL-8, кодируемый вирусом болезни Марека, участвует в ранней цитолитической инфекции, но незаменим для установления латентного периода. J Virol 78: 4753–4760

    CAS PubMed PubMed Central Статья Google Scholar

  • 59.

    Хейдари М., Фицджеральд С.Д., Чжан Х. (2015) Иммунные ответы в миндалинах слепой кишки цыплят, инфицированных вирусом болезни Марека. Avian Dis 59: 213–226

    PubMed Статья Google Scholar

  • 60.

    Baigent SJ, Ross LJ, Davison TF (1998) Дифференциальная восприимчивость к болезни Марека связана с различиями в количестве, но не фенотипе или локализации pp38 + лимфоцитов. J Gen Virol 79: 2795–2802

    CAS PubMed Статья Google Scholar

  • 61.

    Calnek BW, Schat KA, Ross LJ, Chen CL (1984) Дальнейшая характеристика лимфоцитов, инфицированных вирусом болезни Марека. II Инфекция in vitro. Int J Cancer 33: 399–406

    CAS PubMed Статья Google Scholar

  • 62.

    Wu P, Reed WM, Lee LF (2001) Гликопротеины H и L вируса болезни Марека образуют гетероолигомер, необходимый для транслокации и экспрессии на поверхности клетки. Arch Virol 146: 983–992

    CAS PubMed Статья Google Scholar

  • 63.

    Schumacher D, Tischer BK, Reddy SM, Osterrieder N (2001) Гликопротеины E и I серотипа 1 вируса болезни Марека необходимы для роста вируса в культивируемых клетках. J Virol 75: 11307–11318

    CAS PubMed PubMed Central Статья Google Scholar

  • 64.

    Jones KS, Fugo K, Petrow-Sadowski C, Huang Y, Bertolette DC, Lisinski I, Cushman SW, Jacobson S, Ruscetti FW (2006) Использование вируса Т-клеточной лейкемии человека типа 1 (HTLV-1) и HTLV-2 различные рецепторные комплексы для проникновения в Т-клетки. J Virol 80: 8291–8302

    CAS PubMed PubMed Central Статья Google Scholar

  • 65.

    Subramaniam S, Preeyanon L, Cheng HH (2013) Транскрипционное профилирование mEq-зависимых генов в устойчивых к болезни Марека и восприимчивых инбредных линиях кур.PLoS One 8: e78171

    CAS PubMed PubMed Central Статья Google Scholar

  • 66.

    Xu S, Xue C, Li J, Bi Y, Cao Y (2011) микроРНК miR-M3 вируса болезни Марека типа 1 подавляет индуцированный цисплатином апоптоз, воздействуя на Smad2 сигнального пути трансформирующего фактора роста бета. J Virol 85: 276–285

    CAS PubMed Статья Google Scholar

  • 67.

    Zhao Y, Xu H, Yao Y, Smith LP, Kgosana L, Green J, Petherbridge L, Baigent SJ, Nair V (2011) Критическая роль кодируемого вирусом ортолога микроРНК-155 в индукции лимфом болезни Марека. PLoS Pathog 7: e1001305

    CAS PubMed PubMed Central Статья Google Scholar

  • 68.

    Chi JQ, Teng M, Yu ZH, Xu H, Su JW, Zhao P, Xing GX, Liang HD, Deng RG, Qu LH, Zhang GP, Luo J (2015) аналог, кодируемый вирусом болезни Марека. микроРНК-155 активирует онкоген c-Myc, воздействуя на LTBP1 и подавляя сигнальный путь TGF-бета.Вирусология 476: 72–84

    CAS PubMed Статья Google Scholar

  • 69.

    Хейдари М., Фицджеральд С.Д., Чжан Х. (2014) Временная атрофия миндалины, вызванная вирусом болезни Марека. Avian Dis 58: 262–270

    PubMed Статья Google Scholar

  • 70.

    Веллер С.К. (2011) Альфа-герпесвирусы: молекулярная вирусология. Caister Academic, Норфолк

    Google Scholar

  • 71.

    Gonzalez-Navajas JM, Lee J, David M, Raz E (2012) Иммуномодулирующие функции интерферонов типа I. Nat Rev Immunol 12: 125–135

    CAS PubMed PubMed Central Google Scholar

  • 72.

    Fitzgerald-Bocarsly P, Dai J, Singh S (2008) Плазмацитоидные дендритные клетки и IFN типа I: 50 лет конвергентной истории. Фактор роста цитокинов Ред. 19: 3–19

    CAS PubMed PubMed Central Статья Google Scholar

  • 73.

    Toth TE (2000) Неспецифическая клеточная защита дыхательной системы птиц: обзор. Dev Comp Immunol 24: 121–139

    CAS PubMed Статья Google Scholar

  • 74.

    Quere P, Rivas C, Ester K, Novak R, Ragland WL (2005) Изобилие мРНК IFN-альфа и IFN-гамма в крови устойчивых и восприимчивых цыплят, инфицированных вирусом болезни Марека (MDV) или вакцинированных с вирусом герпеса индейки; и ингибирование MDV последующей индукции транскрипции гена IFN.Arch Virol 150: 507–519

    CAS PubMed Статья Google Scholar

  • 75.

    Карака Дж., Анобиле Дж., Даунс Д., Бернсайд Дж., Шмидт С.Дж. (2004) Вирус герпеса индеек: анализ микроматрицы ответов гена хозяина на инфекцию. Вирусология 318: 102–111

    CAS PubMed Статья Google Scholar

  • 76.

    Morgan RW, Sofer L, Anderson AS, Bernberg EL, Cui J, Burnside J (2001) Индукция экспрессии гена-хозяина после инфицирования фибробластов куриного эмбриона онкогенным вирусом болезни Марека.J Virol 75: 533–539

    CAS PubMed PubMed Central Статья Google Scholar

  • 77.

    Xing Z, Schat KA (2000) Ингибирующие эффекты оксида азота и гамма-интерферона на репликацию вируса болезни Марека in vitro и in vivo. J Virol 74: 3605–3612

    CAS PubMed PubMed Central Статья Google Scholar

  • 78.

    Feng ZQ, Lian T, Huang Y, Zhu Q, Liu YP (2013) Характер экспрессии генов RLR-опосредованного противовирусного пути в ответе цыплят различных пород на инфекцию вирусом болезни Марека.Биомед Рес Инт 2013: 419256

    PubMed PubMed Central Google Scholar

  • 79.

    Jarosinski KW, Jia W, Sekellick MJ, Marcus PI, Schat KA (2001) Клеточные ответы у цыплят, получавших перорально IFN-альфа или инокулированных рекомбинантным вирусом болезни Марека, экспрессирующим IFN-альфа. J Интерферон цитокин Res 21: 287–296

    CAS PubMed Статья Google Scholar

  • 80.

    Biron CA (2012) Еще одна роль естественных клеток-киллеров: цитотоксичность в иммунной регуляции и устойчивость вирусов. Proc Natl Acad Sci USA 109: 1814–1815

    CAS PubMed PubMed Central Статья Google Scholar

  • 81.

    Koren S, Fleischmann WR Jr (1993) Пероральные интерфероны подавляют функцию костного мозга. Proc Soc Exp Biol Med 204: 155–164

    CAS PubMed Статья Google Scholar

  • 82.

    De Regge N, Van Opdenbosch N, Nauwynck HJ, Efstathiou S, Favoreel HW (2010) Интерферон альфа индуцирует создание латентного периода альфа-герпеса в сенсорных нейронах in vitro. PLoS One 5: e13076

    PubMed PubMed Central Статья CAS Google Scholar

  • 83.

    Хак К., Элавадли И., Парвизи П., Маллик А.И., Бехбуди С., Шариф С. (2011) Гамма-интерферон влияет на иммунитет, вызываемый вакцинами против очень вирулентного вируса болезни Марека.Antiviral Res 90: 218–226

    CAS PubMed Статья Google Scholar

  • 84.

    Powell PC, Hartley KJ, Mustill BM, Rennie M (1983) Исследования роли макрофагов в болезни Марека у цыплят. J Reticuloendothel Soc 34: 289–297

    CAS PubMed Google Scholar

  • 85.

    Кодама Х., Миками Т., Иноуэ М., Идзава Х. (1979) Ингибирующие эффекты макрофагов против образования бляшек вируса болезни Марека в культурах клеток куриных почек.J Natl Cancer Inst 63: 1267–1271

    CAS PubMed Google Scholar

  • 86.

    Gupta MK, Chauhan HV, Jha GJ, Singh KK (1989) Роль ретикулоэндотелиальной системы в иммунопатологии болезни Марека. Vet Microbiol 20: 223–234

    CAS PubMed Статья Google Scholar

  • 87.

    Djeraba A, Bernardet N, Dambrine G, Quéré P (2000) Оксид азота подавляет репликацию вируса болезни Марека, но не является единственным решающим фактором в подавлении вируса, опосредованном интерфероном гамма.Вирусология 277: 58–65

    CAS PubMed Статья Google Scholar

  • 88.

    Jarosinski KW, Njaa BL, O’Connell PH, Schat KA (2005) Провоспалительные реакции в куриной селезенке и тканях мозга после инфицирования очень вирулентным вирусом плюс болезнь Марека. Viral Immunol 18: 148–161

    CAS PubMed Статья Google Scholar

  • 89.

    Djeraba A, Musset E, Bernardet N, Le Vern Y, Quéré P (2002) Аналогичный паттерн экспрессии iNOS, продукции NO и цитокинового ответа в генетической и привитой устойчивости к болезни Марека.Vet Immunol Immunopathol 85: 63–75

    CAS PubMed Статья Google Scholar

  • 90.

    Куреши М.А., Миллер Л. (1991) Сигнальные требования для приобретения канцероцидной способности куриными перитонеальными макрофагами. Poult Sci 70: 530–538

    CAS PubMed Статья Google Scholar

  • 91.

    Ostuni R, Kratochvill F, Murray PJ, Natoli G (2015) Макрофаги и рак: от механизмов до терапевтических последствий.Trends Immunol 36: 229–239

    CAS PubMed Статья Google Scholar

  • 92.

    Lee LF, Sharma JM, Nazerian K, Witter RL (1978) Подавление митоген-индуцированной пролиферации нормальных клеток селезенки макрофагами от цыплят, инокулированных вирусом болезни Марека. J Immunol 120: 1554–1559

    CAS PubMed Google Scholar

  • 93.

    Гарсия-Камачо Л., Шат К.А., Брукс Р., Баунус Д. (2003) Ранние клеточно-опосредованные иммунные ответы на вирус болезни Марека у двух линий кур с определенными антигенами главного комплекса гистосовместимости.Vet Immunol Immunopathol 95: 145–153

    CAS PubMed Статья Google Scholar

  • 94.

    Сарсон А.Дж., Абдул-Карим М.Ф., Рид Л.Р., Брисбин Дж.Т., Шариф С. (2008) Экспрессия генов, связанных с цитотоксичностью, у цыплят, инфицированных вирусом болезни Марека. Viral Immunol 21: 267–272

    CAS PubMed Статья Google Scholar

  • 95.

    Queré P, Dambrine G (1988) Развитие цитотоксичности, опосредованной противоопухолевыми клетками, во время болезни Марека у кур.Ann Rech Vet 19: 193–201

    PubMed Google Scholar

  • 96.

    Neulen ML, Viertlboeck BC, Straub C, Gobel TW (2015) Идентификация новой популяции куриной CD4 (+) CD3 (-) крови с характеристиками, подобными NK-клеткам. Dev Comp Immunol 49: 72–78

    CAS PubMed Статья Google Scholar

  • 97.

    Черчил А.Е., Пейн Л.Н., Чабб Р.К. (1969) Иммунизация против болезни Марека с использованием живого аттенуированного вируса.Nature 221: 744–747

    Статья Google Scholar

  • 98.

    Schat KA, Markowski-Grimsrud CJ (2001) Иммунные ответы на вирусную инфекцию болезни Марека. Curr Top Microbiol Immunol 255: 91–120

    CAS PubMed Google Scholar

  • 99.

    Эдвардс К.М. (2015) Материнские антитела и иммунные ответы младенцев на вакцины. Вакцина 33: 6469–6472

    CAS PubMed Статья Google Scholar

  • 100.

    Endsley JJ, Roth JA, Ridpath J, Neill J (2003) Материнские антитела блокируют гуморальные, но не Т-клеточные ответы на BVDV. Biologicals 31: 123–125

    CAS PubMed Статья Google Scholar

  • 101.

    Siegrist CA, Barrios C, Martinez X, Brandt C, Berney M, Cordova M, Kovarik J, Lambert PH (1998) Влияние материнских антител на ответы на вакцины: ингибирование ответов антител, но не ответов Т-клеток, позволяет добиться успеха стратегии раннего прайм-буста у мышей.Eur J Immunol 28: 4138–4148

    CAS PubMed Статья Google Scholar

  • 102.

    Niewiesk S (2014) Материнские антитела: клиническое значение, механизм воздействия на иммунные ответы и возможные стратегии вакцинации. Фронт Иммунол 5: 446

    PubMed PubMed Central Статья CAS Google Scholar

  • 103.

    Bandrick M, Theis K, Molitor TW (2014) Материнский иммунитет усиливает вызванные вакцинацией Mycoplasma hyopneumoniae клеточно-опосредованные иммунные ответы у поросят.BMC Vet Res 10: 124

    PubMed PubMed Central Статья CAS Google Scholar

  • 104.

    Gans H, DeHovitz R, Forghani B, Beeler J, Maldonado Y, Arvin AM (2003) Вакцинация от кори и эпидемического паротита как модель для исследования развивающейся иммунной системы: пассивный и активный иммунитет в течение первого года жизни . Вакцина 21: 3398–3405

    CAS PubMed Статья Google Scholar

  • 105.

    White DW, Suzanne Beard R, Barton ES (2012) Иммунная модуляция во время латентной герпесвирусной инфекции. Immunol Rev 245: 189–208

    CAS PubMed PubMed Central Статья Google Scholar

  • 106.

    Hanley PJ, Bollard CM (2014) Контроль цитомегаловируса: помогая иммунной системе взять на себя инициативу. Вирусы 6: 2242–2258

    CAS PubMed PubMed Central Статья Google Scholar

  • 107.

    Шарма Дж. М., Виттер Р. Л. (1975) Влияние иммуносупрессии В-клеток на возрастную устойчивость цыплят к болезни Марека. Cancer Res 35: 711–717

    CAS PubMed Google Scholar

  • 108.

    Markowski-Grimsrud CJ, Schat KA (2002) Ответ цитотоксических Т-лимфоцитов на гликопротеины, кодируемые герпесвирусом болезни Марека. Vet Immunol Immunopathol 90: 133–144

    CAS PubMed Статья Google Scholar

  • 109.

    Гупта С.К., Хароле М.Ю., Калра Д.С. (1982) Роль тимус-зависимой иммунной системы в защите HVT от болезни Марека. Avian Dis 26: 7–13

    CAS PubMed Статья Google Scholar

  • 110.

    Purchase HG, Sharma JM (1974) Облегчение болезни Марека и отсутствие защиты от вакцины у цыплят с иммунодефицитом. Nature 248: 419–421

    CAS PubMed Статья Google Scholar

  • 111.

    Моримура Т., Охаши К., Сугимото С., Онума М. (1998) Патогенез болезни Марека (MD) и возможные механизмы иммунитета, индуцированные вакциной MD. J Vet Med Sci 60: 1–8

    CAS PubMed Статья Google Scholar

  • 112.

    Dalgaard T, Boving MK, Handberg K, Jensen KH, Norup LR, Juul-Madsen HR (2009) Экспрессия MHC на субпопуляциях лимфоцитов селезенки у генетически устойчивых и восприимчивых цыплят, инфицированных вирусом болезни Марека.Viral Immunol 22: 321–327

    CAS PubMed Статья Google Scholar

  • 113.

    Назериан К., Ли Л.Ф., Янагида Н., Огава Р. (1992) Защита от болезни Марека рекомбинантным вирусом оспы домашней птицы, экспрессирующим гликопротеин В вируса болезни Марека. J Virol 66: 1409–1413

    CAS PubMed PubMed Central Google Scholar

  • 114.

    Назериан К., Виттер Р.Л., Ли Л.Ф., Янагида Н. (1996) Защита и синергизм рекомбинантных вакцин против оспы птиц, экспрессирующих гены вируса болезни Марека.Avian Dis 40: 368–376

    CAS PubMed Статья Google Scholar

  • 115.

    Omar AR, Schat KA, Lee LF, Hunt HD (1998) Ответ цитотоксических Т-лимфоцитов у цыплят, иммунизированных рекомбинантным вирусом оспы птиц, экспрессирующим гликопротеин вируса герпеса болезни Марека B. Vet Immunol Immunopathol 62: 73–2

    PubMed Статья Google Scholar

  • 116.

    Мурти К.К., Калнек Б.В. (1979) Поверхностный антиген, ассоциированный с опухолью (матса) болезни Марека, у устойчивых и восприимчивых цыплят.Avian Dis 23: 831–837

    CAS PubMed Статья Google Scholar

  • 117.

    McColl KA, Calnek BW, Harris WV, Schat KA, Lee LF (1987) Экспрессия предполагаемого опухолево-ассоциированного поверхностного антигена на нормальных лимфоцитах, трансформированных вирусом болезни Марека, в сравнении с лимфоцитами, трансформированными вирусом Марека. J Natl Cancer Inst 79: 991–1000

    CAS PubMed Google Scholar

  • 118.

    Podack ER, Strbo N, Sotosec V, Muta H (2002) CD30-регулятор Т-клеток памяти? Ann N Y Acad Sci 975: 101–113

    CAS PubMed Статья Google Scholar

  • 119.

    Sun X, Yamada H, Shibata K, Muta H, Tani K, Podack ER, Iwakura Y, Yoshikai Y (2010) Лиганд CD30 является мишенью для новой биологической терапии против колита, связанного с ответами Th27. J Immunol 185: 7671–7680

    CAS PubMed Статья Google Scholar

  • 120.

    Parvizi P, Andrzejewski K, Read LR, Behboudi S, Sharif S (2010) Профилирование экспрессии генов, связанных с регуляторными функциями субпопуляций Т-клеток у цыплят, инфицированных вирусом болезни Марека.Авиан Патол 39: 367–373

    CAS PubMed Статья Google Scholar

  • 121.

    Matsuyama-Kato A, Murata S, Isezaki M, Kano R, Takasaki S, Ichii O, Konnai S, Ohashi K (2012) Молекулярная характеристика иммуноингибирующих факторов PD-1 / PD-L1 у цыплят, инфицированных Вирус болезни Марека. Вирол J 9:94

    CAS PubMed PubMed Central Статья Google Scholar

  • 122.

    Schub D, Janssen E, Leyking S, Sester U, Assmann G, Hennes P, Smola S, Vogt T, Rohrer T, Sester M, Schmidt T (2015) Измененный фенотип и функциональность специфического клеточного иммунитета к вирусу ветряной оспы у людей при активном заражении. J Infect Dis 211: 600–612

    PubMed Статья Google Scholar

  • 123.

    Parvizi P, Read LR, Abdul-Careem MF, Sarson AJ, Lusty C., Lambourne M, Thanthrige-Don N, Burgess SC, Sharif S (2009) Экспрессия гена цитокинов в подмножествах CD4 + и CD8 + Т-клеток селезенки генетически устойчивых и восприимчивых цыплят, инфицированных вирусом болезни Марека.Vet Immunol Immunopathol 132: 209–217

    CAS PubMed Статья Google Scholar

  • 124.

    Химено И.М. (2008) Вакцины против болезни Марека: решение сегодня, но беспокойство о завтрашнем дне? Вакцина 26 (Приложение 3): C31–41

    CAS PubMed Статья Google Scholar

  • 125.

    Wu C, Gan J, Jin Q, Chen C, Liang P, Wu Y, Liu X, Ma L, Davison F (2009) Ревакцинация вакцинами против болезни Марека вызывает продуктивную инфекцию и повышенный иммунитет.Clin Vaccine Immunol 16: 184–193

    CAS PubMed Статья Google Scholar

  • 126.

    Rouse BT, Kaistha SD (2006) Рассказ о 2 альфа-герпесвирусах: уроки для вакцинологов. Clin Infect Dis 42: 810–817

    PubMed Статья Google Scholar

  • 127.

    Леви AM, Heller ED, Leitner G, Davidson I (1999) Эффект нативного куриного интерферона на репликацию MDV.Acta Virol 43: 121–127

    CAS PubMed Google Scholar

  • 128.

    Yang Q, Wei P, Chen H (2011) Цитокиновые ответы и индуцибельные паттерны экспрессии синтазы закиси азота в микроглии головного мозга новорожденных цыплят, инфицированных очень вирулентным штаммом вируса болезни Марека YL040920. Vet Immunol Immunopathol 142: 14–24

    CAS PubMed Статья Google Scholar

  • 129.

    Bacon LD, Hunt HD, Cheng HH (2001) Генетическая устойчивость к болезни Марека. Curr Top Microbiol Immunol 255: 121–141

    CAS PubMed Google Scholar

  • 130.

    Виттер Р.Л. (2001) Защитная эффективность вакцин против болезни Марека. Curr Top Microbiol Immunol 255: 57–90

    CAS PubMed Google Scholar

  • 131.

    Djeraba A, Kut E, Rasschaert D, Quéré P (2002) Противовирусные и противоопухолевые эффекты рекомбинантного куриного миеломоноцитарного фактора роста при вирусно-индуцированной лимфоме.Int Immunopharmacol 2: 1557–1566

    CAS PubMed Статья Google Scholar

  • 132.

    Gobel TW, Schneider K, Schaerer B, Mejri I, Puehler F, Weigend S, Staeheli P, Kaspers B (2003) IL-18 стимулирует пролиферацию и высвобождение IFN-гамма CD4 + Т-клеток у цыплят : сохранение Th2-подобной системы у видов, не являющихся млекопитающими. J Immunol 171: 1809–1815

    PubMed Статья Google Scholar

  • 133.

    Parvizi P, Mallick AI, Haq K, Haghighi HR, Orouji S, Thanthrige-Don N, St Paul M, Brisbin JT, Read LR, Behboudi S, Sharif S (2012) Лиганд toll-подобного рецептора 3 усиливает защитные эффекты вакцинация против вируса болезни Марека и препятствует развитию опухолей у кур. Вирусный иммунол 25: 394–401

    CAS PubMed Статья Google Scholar

  • 134.

    Parvizi P, Abdul-Careem MF, Mallick AI, Haq K, Haghighi HR, Orouji S, Heidari M, Behboudi S, Sharif S (2014) Эффекты введения лигандов для Toll-подобного рецептора 4 и 21 против болезни Марека у кур.Вакцина 32: 1932–1938

    CAS PubMed Статья Google Scholar

  • 135.

    Haunshi S, Cheng HH (2014) Дифференциальная экспрессия генов пути Toll-подобных рецепторов в фибробластах куриных эмбрионов кур, устойчивых и восприимчивых к болезни Марека. Poult Sci 93: 550–555

    CAS PubMed Статья Google Scholar

  • 136.

    Камил Дж. П., Тишер Б. К., Трапп С., Наир В. К., Остерридер Н., Кунг Х. Дж. (2005) vLIP, гомолог вирусной липазы, является фактором вирулентности вируса болезни Марека.J Virol 79: 6984–6996

    CAS PubMed PubMed Central Статья Google Scholar

  • 137.

    Schippers T, Jarosinski K, Osterrieder N (2015) Ген ORF012 вируса болезни Марека типа 1 продуцирует сплайсированный транскрипт и кодирует новый ядерный фосфопротеин, необходимый для роста вируса. J Virol 89: 1348–1363

    PubMed Статья CAS Google Scholar

  • 138.

    Lee LF, Heidari M, Sun A, Zhang H, Lupiani B, Reddy S (2013) Идентификация и характеристика in vitro рибонуклеотидредуктазы, кодируемой вирусом болезни Марека. Avian Dis 57: 178–187

    PubMed Статья Google Scholar

  • 139.

    Schumacher D, Tischer BK, Trapp S, Osterrieder N (2005) Белок, кодируемый ортологом US3 вируса болезни Марека, необходим для эффективного развития перинуклеарных вирионов и участвует в разрушении актиновых стрессовых волокон.J Virol 79: 3987–3997

    CAS PubMed PubMed Central Статья Google Scholar

  • 140.

    Chbab N, Egerer A, Veiga I, Jarosinski KW, Osterrieder N (2010) Вирусный контроль экспрессии vTR имеет решающее значение для эффективного образования и распространения лимфомы, вызванной вирусом болезни Марека (MDV). Vet Res 41:56

    PubMed PubMed Central Статья CAS Google Scholar

  • 141.

    Тахири-Алауи А., Смит Л.П., Кгосана Л., Петербридж Л.Дж., Наир В. (2013) Идентификация фактора нейровирулентности из вируса болезни Марека. Avian Dis 57: 387–394

    PubMed Статья Google Scholar

  • 142.

    Trapp-Fragnet L, Bencherit D, Chabanne-Vautherot D, Le Vern Y, Remy S, Boutet-Robinet E, Mirey G, Vautherot JF, Denesvre C (2014) Модуляция клеточного цикла вирусом болезни Марека: белок-тегумент VP22 запускает остановку S-фазы и повреждение ДНК в пролиферирующих клетках.PLoS One 9: e100004

    PubMed PubMed Central Статья CAS Google Scholar

  • 143.

    Tischer BK, Schumacher D, Chabanne-Vautherot D, Zelnik V, Vautherot JF, Osterrieder N (2005) Высокий уровень экспрессии гликопротеина C вируса болезни Марека вреден для роста вируса in vitro. J Virol 79: 5889–5899

    CAS PubMed PubMed Central Статья Google Scholar

  • 144.

    Chbab N, Chabanne-Vautherot D, Francineau A, Osterrieder N, Denesvre C, Vautherot JF (2009) Белок вируса болезни Марека (MDV), кодируемый ортологом UL17, необходим для роста вируса. Vet Res 40:28

    PubMed PubMed Central Статья CAS Google Scholar

  • Прекращение репликации вируса болезни Марека с использованием CRISPR / Cas9

  • 1.

    Остерридер, Н., Камил, Дж. П., Шумахер, Д., Тишер, Б. К.И Трапп, вирус болезни Марека: от миазмов к модели. Nat. Rev. Microbiol. 4 , 283–294. https://doi.org/10.1038/nrmicro1382 (2006).

    CAS Статья PubMed Google Scholar

  • 2.

    Морроу, К. и Фелер, Ф. Болезнь Марека: всемирная проблема. Curr. Top Microbiol. https://doi.org/10.1016/B978-0-12-088379-0.X5000-2 (2004).

    Артикул Google Scholar

  • 3.

    Наир, В. Латентный период и онкогенез при болезни Марека. Avian Dis. 57 , 360–365. https://doi.org/10.1637/10470-121712-Reg.1 (2013).

    Артикул PubMed Google Scholar

  • 4.

    Парселлс, М.С., Бернсайд, Дж. И Морган, Р. В. Т-клеточные лимфомы, вызванные вирусом болезни Марека. Cancer Assoc. Вирусы https://doi.org/10.1007/978-1-4614-0016-5_13 (2012).

    Артикул Google Scholar

  • 5.

    Наир, В. Эволюция болезни Марека - парадигма непрекращающейся гонки между патогеном и хозяином. Вет. J. (Лондонский английский язык, 1997 г.) 170 , 175–183. https://doi.org/10.1016/j.tvjl.2004.05.009 (2005).

    CAS Статья Google Scholar

  • 6.

    Бублот М. и Шарма Дж. Вакцинация против болезни Марека. Curr. Top Microbiol. https://doi.org/10.1016/B978-0-12-088379-0.X5000-2 (2004).

    Артикул Google Scholar

  • 7.

    Рид, A. F. et al. Несовершенная вакцинация может усилить передачу высоковирулентных патогенов. PLoS Biol https://doi.org/10.1371/journal.pbio.1002198 (2015).

    Артикул PubMed PubMed Central Google Scholar

  • 8.

    Бертцбах, Л. Д., Хеймар, А., Али, Ф. А. З. и Кауфер, Б.B. Вирусные факторы, участвующие в патогенезе вируса болезни Марека (MDV). Curr. Clin. Microbiol. Реп. 5 , 238–244. https://doi.org/10.1007/s40588-018-0104-z (2018).

    Артикул Google Scholar

  • 9.

    Пеллетт П. Э. и Ройзман Б. В Филдс вирусология (ред. Хоули П. М. и Книп Д. М.) 2479–2499 (Липпинкотт-Рэйвен, Филадельфия, 2007).

    Google Scholar

  • 10.

    Бейджент, С. Дж. И Дэвисон, Вирус болезни Ф. Марека: Биология и жизненный цикл. Curr. Top Microbiol. https://doi.org/10.1016/B978-0-12-088379-0.X5000-2 (2004).

    Артикул Google Scholar

  • 11.

    Остерридер, Н. и Вотерот, Дж. Ф. Состав генома вирусов, подобных болезни Марека. Curr. Top Microbiol. https://doi.org/10.1016/B978-012088379-0/50007-4 (2004).

    Артикул Google Scholar

  • 12.

    Веллер, С. К. и Коэн, Д. М. Вирусы простого герпеса: механизмы репликации ДНК. Cold Spring Harb Perspect Biol. 4 , a013011. https://doi.org/10.1101/cshperspect.a013011 (2012).

    CAS Статья PubMed PubMed Central Google Scholar

  • 13.

    Куханова М.К., Коровина А.Н., Кочетков С.Н. Вирус простого герпеса человека: жизненный цикл и развитие ингибиторов. Биохимия (Моск.) 79 , 1635–1652.https://doi.org/10.1134/S0006297

  • 0124 (2014).

    CAS Статья Google Scholar

  • 14.

    Бутелл, К. и Эверетт, Р. Д. Регулирование альфа-герпесвирусных инфекций с помощью семейства белков ICP0. J Gen Virol 94 , 465–481. https://doi.org/10.1099/vir.0.048900-0 (2013).

    CAS Статья PubMed Google Scholar

  • 15.

    Хильдебрандт, Э., Данн, Дж. Р., Ниикура, М. и Ченг, Х. Х. Мутации внутри ICP4, полученные во время ослабления in vitro, не изменяют вирулентность рекомбинантных вирусов болезни Марека in vivo. Virol. Реп. 5 , 10–18. https://doi.org/10.1016/j.virep.2014.11.002 (2015).

    Артикул Google Scholar

  • 16.

    Бёмер П. Э. и Нимонкар А. В. Репликация вируса герпеса. IUBMB Life 55 , 13–22.https://doi.org/10.1080/1521654031000070645 (2003).

    CAS Статья PubMed Google Scholar

  • 17.

    Ройзман Б. В Филдс вирусология (ред. Хоули, М. и Книп, Д. М.) 2501–2602 (Липпинкотт-Рэйвен, Филадельфия, 2007).

    Google Scholar

  • 18.

    Меттенлейтер, Т. К. Интригующее взаимодействие между вирусными белками во время сборки вируса герпеса или: Загадка сборки вируса герпеса. Вет. Microbiol. 113 , 163–169. https://doi.org/10.1016/j.vetmic.2005.11.040 (2006).

    CAS Статья PubMed Google Scholar

  • 19.

    Mettenleiter, T. C. Сборка и выход герпесвируса. J. Virol. 76 , 1537–1547. https://doi.org/10.1128/jvi.76.4.1537-1547.2002 (2002).

    CAS Статья PubMed PubMed Central Google Scholar

  • 20.

    Мали, П., Эсвелт, К. М. и Черч, Г. М. Cas9 как универсальный инструмент для инженерной биологии. Nat. Методы 10 , 957–963. https://doi.org/10.1038/nmeth.2649 (2013).

    CAS Статья PubMed PubMed Central Google Scholar

  • 21.

    Хорват П. и Баррангу Р. CRISPR / Cas, иммунная система бактерий и архей. Наука 327 , 167–170. https://doi.org/10.1126 / science.1179555 (2010).

    ADS CAS Статья Google Scholar

  • 22.

    Виденхефт, Б., Штернберг, С. Х. и Дудна, Дж. А. РНК-зависимые системы генетического сайленсинга у бактерий и архей. Природа 482 , 331–338. https://doi.org/10.1038/nature10886 (2012).

    ADS CAS Статья PubMed Google Scholar

  • 23.

    Штернберг, С.Х. и Дудна, Дж. А. Расширение набора инструментов биолога с помощью CRISPR-Cas9. Мол. Мобильный 58 , 568–574. https://doi.org/10.1016/j.molcel.2015.02.032 (2015).

    CAS Статья PubMed Google Scholar

  • 24.

    Tang, N. et al. Простой и быстрый подход к разработке рекомбинантных вакцин с вектором птичьего герпеса с использованием системы CRISPR / Cas9. Вакцина 36 , 716–722.https://doi.org/10.1016/j.vaccine.2017.12.025 (2018).

    CAS Статья PubMed PubMed Central Google Scholar

  • 25.

    Zhang, Y. et al. Применение системы редактирования генов CRISPR / Cas9 на геноме MDV-1 для изучения функции генов. Вирусов https://doi.org/10.3390/v10060279 (2018).

    Артикул PubMed PubMed Central Google Scholar

  • 26.

    van Diemen, F. R. et al. CRISPR / Cas9-опосредованное редактирование генома герпесвирусов ограничивает продуктивные и латентные инфекции. PLoS Pathog. 12 , e1005701. https://doi.org/10.1371/journal.ppat.1005701 (2016).

    CAS Статья PubMed PubMed Central Google Scholar

  • 27.

    Палларес Масмитиа, М., Кнодлседер, Н. и Гуэль, М. Дизайн CRISPR-гРНК. Methods Mol. Биол. 1961 , 3–11.https://doi.org/10.1007/978-1-4939-9170-9_1 (2019).

    CAS Статья PubMed Google Scholar

  • 28.

    Liu, X. et al. Особенности последовательности, связанные с эффективностью расщепления системы CRISPR / Cas9. Sci. Реп. 6 , 19675. https://doi.org/10.1038/srep19675 (2016).

    ADS CAS Статья PubMed PubMed Central Google Scholar

  • 29.

    Wang, G., Zhao, N., Berkhout, B. & Das, A. T. Комбинаторная атака CRISPR-Cas9 на ДНК ВИЧ-1 уничтожает все инфекционные провирусы в инфицированных культурах Т-клеток. Cell Rep. 17 , 2819–2826. https://doi.org/10.1016/j.celrep.2016.11.057 (2016).

    CAS Статья PubMed Google Scholar

  • 30.

    Lebbink, R.J. et al. Комбинированный подход к редактированию генов CRISPR / Cas9 может остановить репликацию ВИЧ и предотвратить утечку вируса. Sci. Реп. 7 , 41968. https://doi.org/10.1038/srep41968 (2017).

    ADS CAS Статья PubMed PubMed Central Google Scholar

  • 31.

    Shibata, M. et al. Динамика CRISPR-Cas9 в реальном пространстве и в реальном времени, визуализированная с помощью высокоскоростной атомно-силовой микроскопии. Nat. Commun. 8 , 1430. https://doi.org/10.1038/s41467-017-01466-8 (2017).

    ADS CAS Статья PubMed PubMed Central Google Scholar

  • 32.

    Уайт, М. К., Ху, В. и Халили, К. Подходы к редактированию генов против вирусных инфекций и стратегия предотвращения утечки вирусов. PLoS Pathog. 12 , e1005953. https://doi.org/10.1371/journal.ppat.1005953 (2016).

    CAS Статья PubMed PubMed Central Google Scholar

  • 33.

    Тао, П., Ву, X. и Рао, В. Неожиданная эволюционная польза фагам, передаваемая бактериальным CRISPR-Cas9. Sci. Adv. 4 , 4134. https://doi.org/10.1126/sciadv.aar4134 (2018).

    ADS CAS Статья Google Scholar

  • 34.

    Schat, K. & Purchase, H. Методы культивирования клеток. Лабораторное руководство по изоляции и идентификации птичьих патогенов . 4 изд., 223–234 (Американская ассоциация патологов птиц, 1998 г.).

  • 35.

    Остерридер, Н. Последовательность и начальная характеристика гомологичных генов U (L) 10 (гликопротеин М) и U (L) 11 вируса болезни Марека серотипа 1. Arch. Virol. 144 , 1853–1863 (1999).

    CAS Статья PubMed Google Scholar

  • 36.

    Jordan, I. et al. Непрерывные линии клеток московской утки в качестве потенциальной замены первичных клеток при производстве вакцин для птиц. Avian Pathol. 45 , 137–155. https://doi.org/10.1080/03079457.2016.1138280 (2016).

    Артикул PubMed Google Scholar

  • 37.

    Bertzbach, L. D. et al. Транскрипционный ландшафт вируса болезни Марека в первичных куриных В-клетках обнаруживает новые варианты сплайсинга и гены. Вирусов https://doi.org/10.3390/v11030264 (2019).

    Артикул PubMed PubMed Central Google Scholar

  • 38.

    Берцбах, Л. Д., ван Харлем, Д. А., Хертле, С., Кауфер, Б. Б. и Янсен, К. А. Инфекция естественных клеток-киллеров вирусом болезни Марека. Микроорганизмы https://doi.org/10.3390/microorganisms7120588 (2019).

    Артикул PubMed PubMed Central Google Scholar

  • 39.

    Schumacher, D., Tischer, BK, Fuchs, W. & Osterrieder, N. Восстановление серотипа 1 вируса болезни Марека (MDV-1) из ДНК, клонированной в качестве бактериальной искусственной хромосомы, и характеристика гликопротеина B -отрицательный мутант MDV-1. J. Virol. 74 , 11088–11098.https://doi.org/10.1128/Jvi.74.23.11088-11098.2000 (2000).

    CAS Статья PubMed PubMed Central Google Scholar

  • 40.

    van de Weijer, M. L. et al. Скрининг shRNA с высоким охватом идентифицирует TMEM129 как лигазу E3, участвующую в ER-ассоциированной деградации белка. Nat Commun 5 , 3832. https://doi.org/10.1038/ncomms4832 (2014).

    ADS CAS Статья PubMed PubMed Central Google Scholar

  • 41.

    Heckl, D. et al. Создание мышиных моделей миелоидного злокачественного новообразования с комбинаторными генетическими поражениями с использованием редактирования генома CRISPR-Cas9. Nat Biotechnol 32 , 941–946. https://doi.org/10.1038/nbt.2951 (2014).

    CAS Статья PubMed PubMed Central Google Scholar

  • 42.

    Лабун, К., Монтегю, Т. Г., Ганьон, Дж. А., Тайм, С. Б. и Вален, Е. CHOPCHOP v2: веб-инструмент для нового поколения геномной инженерии CRISPR. Nucleic Acids Res 44 ​​, W272-276. https://doi.org/10.1093/nar/gkw398 (2016).

    CAS Статья PubMed PubMed Central Google Scholar

  • 43.

    Montague, T. G., Cruz, J. M., Gagnon, J. A., Church, G. M. & Valen, E. CHOPCHOP: веб-инструмент CRISPR / Cas9 и TALEN для редактирования генома. Nucleic Acids Res 42 , W401-407. https://doi.org/10.1093/nar/gku410 (2014).

    CAS Статья PubMed PubMed Central Google Scholar

  • 44.

    Bainbridge, J. W. B. et al. Перенос гена in vivo в глаз мыши с использованием лентивирусного вектора на основе ВИЧ; эффективная долговременная трансдукция эндотелия роговицы и пигментного эпителия сетчатки. Gene Ther. 8 , 1665–1668. https://doi.org/10.1038/sj.gt.3301574 (2001).

    CAS Статья PubMed Google Scholar

  • 45.

    Конради, А. М., Бертцбах, Л. Д., Бхандари, Н., Парселлс, М.& Кауфер, Б. Б. Обычная живая аттенуированная вакцина против птичьего герпеса экспрессирует очень мощный онкоген. mSphere https://doi.org/10.1128/mSphere.00658-19 (2019).

    Артикул PubMed PubMed Central Google Scholar

  • 46.

    Jarosinski, K. W., Osterrieder, N., Nair, V. K. и Schat, K. A. Ослабление вируса болезни Марека путем делеции открытой рамки считывания RLORF4, но не RLORF5a. J. Virol. 79 , 11647–11659.https://doi.org/10.1128/Jvi.79.18.11647-11659.2005 (2005).

    CAS Статья PubMed PubMed Central Google Scholar

  • 47.

    Bertzbach, L.D. et al. Раскрытие роли В-клеток в патогенезе онкогенного вируса герпеса птиц. Proc. Natl. Акад. Sci. США 115 , 11603–11607. https://doi.org/10.1073/pnas.1813964115 (2018).

    CAS Статья PubMed Google Scholar

  • Клональная структура CD4 + лимфом с быстрым началом MDV и отвечающих CD8 + Т-клеток

    Abstract

    Лимфоидный онкогенез - опасное для жизни осложнение, связанное с рядом стойких вирусных инфекций (например,г. EBV и HTLV-1 у человека). Со многими из этих инфекций трудно изучить их естественную историю и динамику образования опухоли. Вирус болезни Марека (MDV) - это распространенный α-герпесвирус домашней птицы, вызывающий опухоли CD4 + TCRαβ + Т-клеток у восприимчивых хозяев. Высокая пенетрантность и предсказуемость во времени индукции опухоли поднимают вопросы, связанные с клональной структурой этих лимфом. Точно так же неизвестна клональность отвечающих CD8 Т-клеток, которые проникают в опухолевые участки. Используя инструменты анализа репертуара TCRβ, мы продемонстрировали, что в опухолях CD4 + Т-клеток, управляемых MDV, преобладают от одного до трех больших клонов в олигоклональной структуре меньших клонов CD4 + Т-клеток.У отдельных птиц было несколько участков опухоли, некоторые из которых были результатом метастазов (то есть общих доминантных клонов), а другие произошли от отдельных клонов трансформированных клеток. Олигоклональные CD4 + клетки меньшего размера могут представлять противоопухолевый ответ, хотя в одном случае низкочастотный клон был трансформирован и размножен после культивирования. Клоны метастатических опухолей были обнаружены в крови на ранней стадии инфицирования и преобладали в репертуаре циркулирующих Т-клеток, что приводило к иммуносупрессии, связанной с MDV. Мы также продемонстрировали, что в ответе CD8 + Т-клеток, инфильтрирующих опухоль, преобладали большие олигоклональные экспансии, содержащие как «общедоступные», так и «частные» последовательности CDR3.Частота CD8 + Т-клеточных последовательностей CDR3 предполагает начальную стимуляцию на ранних этапах инфекции. В совокупности наши результаты показывают, что в опухолях, управляемых MDV, преобладает очень ограниченное количество клонов CD4 +. Более того, инфильтрат отвечающих CD8 + Т-клеток является олигоклональным, что указывает на распознавание ограниченного числа антигенов MDV. Эти исследования улучшают наше понимание биологии MDV, важного патогена для домашней птицы и модели естественной инфекции, вызываемой вирусным образованием опухоли.

    Резюме автора

    Многие вирусные инфекции нацелены на иммунную систему, используя долгоживущие высокопролиферативные лимфоциты для размножения и выживания в организме хозяина. Эта характеристика привела к ассоциации между некоторыми вирусами, такими как вирус Эпштейна-Барра (EBV), лимфотрофным вирусом-1 Т-клеток человека (HTLV-1) и вирусом болезни Марекса (MDV), и лимфоидными опухолями. Мы использовали методы идентификации репертуара Т-клеточных рецепторов в виде молекулярного штрих-кода для изучения биологии MDV-индуцированных опухолей и противоопухолевого ответа.Каждый человек содержал небольшое количество больших (высокочастотных) опухолевых клонов наряду с некоторыми меньшими (более низкими) клонами в популяции CD4 + Т-клеток. Ответ опухоли на инфильтрацию CD8 + Т-клеток был сильно сфокусирован на небольшом количестве больших клонов, один из которых представлял общедоступную последовательность CDR3. Эти данные согласуются с распознаванием небольшого числа доминантных антигенов, и понимание взаимосвязи между ними и защитным иммунитетом важно для улучшения разработки новых стратегий вакцинации.В совокупности наши результаты дают представление о клональной структуре опухолей, управляемых MDV, и о компартменте отвечающих CD8 + Т-клеток. Эти исследования продвигают наше понимание биологии MDV, важного заболевания домашней птицы и модели естественной инфекции, вызванной вирусным образованием опухолей.

    Образец цитирования: Mwangi WN, Smith LP, Baigent SJ, Beal RK, Nair V, Smith AL (2011) Клональная структура быстроразвивающихся MDV-управляемых лимфом CD4 + и отвечающих CD8 + Т-клеток. PLoS Pathog 7 (5): e1001337.https://doi.org/10.1371/journal.ppat.1001337

    Редактор: Николаус Остеридер, Свободный университет Берлина, Германия

    Поступила: 21 июля 2010 г .; Принята к печати: 5 апреля 2011 г .; Опубликовано: 5 мая 2011 г.

    Авторские права: © 2011 Mwangi et al. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

    Финансирование: Эта работа была в основном поддержана DEFRA-HEFCE (грант № VT-0104) и DEFRA (OD0718). ALS и VN признаны исследователями Дженнера и получают поддержку от Института Дженнера, Оксфорд, Великобритания. Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

    Конкурирующие интересы: Авторы заявили, что конкурирующих интересов не существует.

    Введение

    Лимфоидный онкогенез, управляемый вирусами, является серьезным последствием инфицирования широким спектром герпесных и ретровирусных патогенов у различных хозяев.К основным инфекциям человека, связанным с лимфомой, относятся вирус Эпштейна-Барра (ВЭБ) и Т-клеточный лимфотропный вирус человека (HTLV) [1], [2]. Как при EBV, так и при HTLV, прогрессирование опухоли - относительно редкое событие, учитывая распространенность инфекции и персистирующий характер вируса [2], [3]. Напротив, вирус болезни Марека (MDV) представляет собой широко распространенную онкогенную α-герпесвирусную инфекцию кур, которая легко вызывает лимфоидные опухоли и оказывает огромное влияние на птицеводство [4]. Онкогенность MDV в сочетании со способностью вакцинировать против образования опухолей делает систему MDV-курица отличной моделью естественной инфекции для понимания биологии и лечения вирусно-индуцированных лимфом [1], [5] - [7].

    Распространение MDV происходит при вдыхании инфекционных частиц в пыли. После короткой литической фазы в В-лимфоцитах (от 2 до 7 дней после инфицирования [dpi]) MDV устанавливает пожизненную латентную инфекцию в CD4 + Т-лимфоцитах [8]. Жизненный цикл завершается переносом MDV в эпителий перьевого фолликула [8]. У восприимчивых птиц инфекция MDV приводит к высокой частоте опухолей CD4 + Т-клеток (до 100%) в широком диапазоне органов, включая сердце, печень, яичники, семенники, легкие и кожу [9] - [14].Эти опухоли CD4 + экспрессируют высокие уровни CD30, члена семейства рецепторов фактора некроза опухолей II, который также чрезмерно экспрессируется на лимфомах человека различной этиологии [5]. Латентность MDV и образование опухоли зависят от кодируемых вирусами генов, таких как EcoRI-Q (meq), молекулы, родственной c-Jun [15] - [17].

    Пенетрантность (до 100%) и временная воспроизводимость появления опухоли после инфицирования (в течение 3-4 недель) у восприимчивых линий птиц поднимают важные вопросы, касающиеся клональности опухоли.Они включают клональность трансформированных клеток в отдельных сайтах и ​​между сайтами, где у одного человека очевидны множественные дискретные солидные опухоли. Геном MDV легко интегрируется в геном клетки-хозяина, особенно в теломерных или субтеломерных местах [18], [19]. Профиль интеграции MDV в опухолевую клетку-хозяин предполагает ограниченную клональность большинства клеточных линий, производных от болезни Марека, и клеток, взятых из участков опухоли [18], [19]. В каждом образце было обнаружено от двух до двенадцати независимых сайтов интеграции, и образец интеграции в культуре был стабильным с течением времени.Напротив, анализ использования Т-клеточного рецептора (TCR) семейства Vβ в клетках CD30 hi из первичных лимфом привел к заключению, что опухоли MD были поликлональными [10]. Во время анализа паттернов интеграции MDV образцы, полученные от одной курицы, содержали по крайней мере два основных различных паттерна [19], предполагая по крайней мере два независимых события трансформации. Эти данные в сочетании с возможностью предпочтительных сайтов для интеграции MDV [например, теломерные или субтеломерные предпочтения [19]] предполагают, что анализ клональности, зависящий от невирусных сайтов интеграции, будет подходящим.Поскольку опухоли происходят из CD4 + Т-клеток, клонально экспрессируемый Т-клеточный рецептор (TCR) может быть подходящей мишенью для молекулярного определения клональности опухоли.

    Разработка успешных противоопухолевых вакцин против MDV имела решающее значение для птицеводства и привела к предложению использования MDV в качестве модели для разработки вакцин против других вирусных инфекций, вызывающих лимфому, рассмотренных в [1], [6]. Вакцины очень эффективны в предотвращении образования опухолей, но не устраняют инфекцию или не блокируют передачу в течение длительного периода времени [20].Периодически циркулирующие штаммы MDV развивают повышенную патогенность, и отказ от вакцины потребовал разработки различных поколений вакцин за последние 50 лет [Обзор в [21], [22]]. Успех вакцинации указывает на приобретение защитного адаптивного иммунитета, и ответы как антител, так и Т-клеток легко обнаруживаются [23], [24]. Другие доказательства иммунной защиты включают ассоциацию генетической устойчивости с гаплотипом MHC (локус B) [25] - [29]. Точно так же естественная инфекция вызывает поддающиеся измерению естественные клетки-киллеры, антитела, Т-клетки, цитокины и ответы интерферона [30] - [34].Сильно ассоциированная с клетками природа MDV подтверждает мнение о том, что клеточно-опосредованные ответы могут преобладать в защитном иммунитете (обзор [23], [35], [36] с опосредованным CD8 + T-клетками цитотоксическим уничтожением, продемонстрированным в нескольких исследованиях [37] - [ 39]. Цитотоксическая активность в MHC B 19 и B 21 гомозиготных цыплят была сосредоточена на кодируемых MDV антигенах pp38, meq и gB [38]. Важно отметить, что временное истощение CD8 + Т-клеток сделало цыплят более восприимчивыми к инфекции. с MDV [40].Ответ на стойкие вирусные инфекции у людей часто характеризуется цитотоксическими Т-клетками, специфичными для антигенов, ассоциированных с латентным периодом. Действительно, большие клоны Т-клеток легко обнаруживаются во время инфицирования ЦМВ [41], [42] и ВЭБ [2], [43], [44]. Этот тип клональной структуры в CD8 + Т-клетках указывает на ответ, сосредоточенный на очень небольшом количестве антигенов.

    Проблема клональности опухоли и природы ответа CD8 + Т-клеток во время инфекции MDV побудила к применению инструментов анализа репертуара рецепторов Т-клеток, которые мы недавно разработали для цыплят [45].Локус TCRβ цыпленка у кур намного проще, чем у млекопитающих, содержащий 13 вариабельных (V), 1 разнообразных (D), 4 соединяющихся (J) сегмента и 1 сегмент C [45] - [49]. Сегменты Vβ группируются в два семейства, что упрощает глобальный анализ репертуара TCR цыплят. Мы применили комбинацию анализа длины CDR3 (спектральное типирование) и секвенирования соединения VDJ (также известного как комплементарная определяющая область 3 [CDR3]) для определения клональности клеточных линий MDV и различных популяций клеток из опухолей или других участков в пределах Птицы, инфицированные MDV.Эти подходы выявили клональную структуру в опухолях MDV (но не всегда моноклональную) и паттерн общего и отличного клонального происхождения в разных участках у одного человека. Анализ инфильтрирующих опухоль и CD8 + Т-клеток селезенки позволил идентифицировать большие клоны Т-клеток в олигоклональной структуре отвечающих CD8 + Т-клеток.

    Материалы и методы

    Экспериментальная инфекция

    Инбредная линия P (MHC, B 19/19 ) цыплят белого леггорна выращивали без патогенов в птицеводческом отделении Института здоровья животных.Однодневных птиц заражали штаммом MDV RB-1B [50] путем интраабдоминальной инъекции вируса, связанного с клетками ~ 1000 БОЕ, и наблюдали за развитием БМ с использованием методов, описанных ранее [51], [52]. Две птицы (15 и 16) были сторожевыми птицами и инфицированы экспериментально зараженными птицами. Птицы были выращены с ad libitum доступом к воде и рациону на основе овощей (Special Diet Services, Witham, UK) и окаймляли крылья, чтобы можно было идентифицировать особей.

    Заявление о соблюдении этических норм

    Это исследование было проведено в соответствии с инструкциями и постановлениями Министерства внутренних дел Великобритании с соответствующими личными и проектными лицензиями (номер лицензии 30/2621). В рамках этого процесса работа прошла тщательную проверку и одобрение этическим комитетом Института здоровья животных.

    Подготовка клеток, проточная цитометрия и сортировка

    Одноклеточные суспензии лимфоцитов получали из селезенки, крови и опухолевых тканей центрифугированием в градиенте плотности Histopaque-1083 (Sigma-Aldrich, Steinheim, Германия).Популяции CD4 + и CD8 + Т-клеток выделяли с помощью положительной магнитной сортировки клеток (AutoMACS Pro Separator, Miltenyi Biotec, Bergisch Gladbach, Германия) в соответствии с инструкциями производителя, используя конъюгированные с FITC мышиные антитела против куриного CD4, клон CT-4 и антитела против куриного CD8β. клон EP42 [[53]; SouthernBiotech, Бирмингем, Алабама, США)] и микрогранулы козьего антимышиного IgG (Miltenyi Biotec). После каждой обработки антителами клетки промывали трижды PBS, содержащим 0,5% бычьего сывороточного альбумина, с центрифугированием при 450 x g в течение 10 мин.Чистота отсортированных клеток по данным проточной цитометрии составила> 99%.

    Культура клеток и поддержание установленных линий клеток

    Установленные линии клеток лимфомы, полученные из опухолей, индуцированных MDV-1, включали MSB1 [54], HP8 [55] и HP18 [56], RPL-1 [57]. Четыре дополнительные клеточные линии MDV были получены от четырех птиц линии P, инфицированных pRB-1B5 [51], из опухолей семенников (T), яичников (O) и селезенки (S) в соответствии со стандартными методами [56]. Им присвоены следующие идентификаторы 4523 (T), 4525 (O), 4590 (S) и 760 (O).CD4 + T-клеточная линия AVOL-1 [58], [59], трансформированная вирусом ретикулоэндотелиоза T (штамм REV-T), была включена в качестве MDV-отрицательной трансформированной клеточной линии. Клеточные линии выращивали при 38,5 ° C в 5% CO 2 в среде RPMI 1640, содержащей 10% эмбриональной сыворотки теленка, 10% триптозофосфатного бульона и 1% пирувата натрия.

    Выделение РНК

    Образцы тканей хранили в RNAlater (QIAGEN Ltd. Crawley, Великобритания) при -20 ° C перед разрушением путем гомогенизации (Mini-bead beater; Biospec Products, Bartlesville, Okla.). Выделенные подмножества клеток или культивированные клетки разрушали ресуспендированием в буфере RLT (QIAGEN) и хранили при -20 ° C. РНК экстрагировали с помощью набора RNeasy Mini (QIAGEN) в соответствии с инструкциями производителя. Загрязняющую ДНК расщепляли на колонке с ДНКазой 1, не содержащей РНКаз (QIAGEN), в течение 15 мин при комнатной температуре. РНК элюировали 50 мкл воды, свободной от РНКазы (QIAGEN), и хранили при -80 ° C.

    Обратная транскрипция

    Реакции обратной транскрипции проводили с использованием системы обратной транскрипции iScript (набор для синтеза кДНК iScript Select, Bio-Rad, США) в соответствии с инструкциями производителя, используя 2 мкг выделенной РНК из каждого образца и олиго (dT) праймеры.Для каждого образца получали двадцать мкл кДНК и хранили при -20 ° C.

    Полимеразная цепная реакция (ПЦР)

    ПЦР проводили по стандартным протоколам. Вкратце, кДНК (2 мкл) инкубировали с 200 мкМ dNTP, 1,5 мМ MgCl 2 , 1x реакционным буфером [50 мМ KCl, 20 мМ Tris-HCl (pH 8,4)], 2 единицами ДНК-полимеразы Platinum Taq (Invitrogen), 1 мкл каждого праймера при рабочей концентрации 10 мкМ в конечном реакционном объеме 50 мкл. Прямой праймер, использованный для Vβ1 и Vβ2, представлял собой 5'ACAGGTCGACCTGGGAGACTCTCTGA CTCTGAACTG-3 'и 5'-CACGGTCGACGATGAGAACGCTACCCTGAGATGC-3', соответственно, с общим обратным праймером Cβ 5'ACAGGTCGACGTACCACCACCA [3 '].Локус TCRβ находится на хромосоме 1 с дизайном праймеров Vβ и Cβ на основе геномной последовательности (версия 82; http://www.ensembl.org/Gallus_gallus), как описано ранее (45). Использование праймеров, которые лежат в консервативных областях сегментов TCR, сводит к минимуму любую систематическую ошибку, связанную с амплификацией ПЦР. Анализ последовательности образцов, полученных от неинфицированных птиц, выявляет поликлональную популяцию амплифицированного TCR CDR3 без признаков смещения ПЦР (45 и наши неопубликованные данные).

    Условия ПЦР были следующими: один цикл, 94 ° C в течение 2 минут, затем 35 циклов при 94 ° C в течение 30 секунд, 50 ° C в течение 40 секунд и 72 ° C в течение 1 минуты, затем один цикл при 72 ° C. C в течение 10 мин с использованием термоциклера G-storm (Gene Technologies, Эссекс, Великобритания) или мастерциклера Eppendorf (Eppendorf, Гамбург, Германия).Амплифицированные продукты анализировали электрофорезом через 1% агарозные гели (Sigma-Aldrich Ltd, Пул, Великобритания) в 1x буфере трис-борат-ЭДТА при 50 мА в течение 1 часа, и продукты визуализировали путем окрашивания бромидом этидия (Bio-Rad, Ltd) или окрашивание нуклеиновой кислотой GelRed (Biotium).

    продуктов ПЦР очищали с использованием набора для очистки QIAquick PCR (Qiagen Ltd) в соответствии с инструкциями производителя. ДНК элюировали 50 мкл воды, свободной от нуклеаз, и хранили при -20 ° C.

    Клонирование и секвенирование продуктов ПЦР

    Для определения последовательности экспрессированной Vβ-цепи продукты ПЦР клонировали непосредственно в вектор pCR4-TOPO (Invitrogen) и использовали для трансформации компетентных E.coli , TOP10 (Invitrogen) в соответствии с инструкциями производителя. После инкубации на чашках с селективным агаром LB, содержащим 100 мкг / мл ампициллина (Sigma), отбирали отдельные бактериальные колонии и скринировали на вставку правильного размера с помощью ПЦР с последующим электрофорезом в агарозном геле. Положительные колонии обрабатывали с помощью набора Qiagen Miniprep (Qiagen Ltd) и затем секвенировали с помощью плазмид-специфичного (M13 вперед; 5'-GTAAAACGACGGCCAG-3'или M13 обратный; 5'-CAGGAAACAGCTATGAC-3 ') или обратного праймера Cβ (5 ′ -TGTGGCCTTCTTCTTCTCTTG-3 ′).Альтернативно, вставку плазмиды, амплифицированную с помощью ПЦР, очищали с использованием набора для очистки QIAquick PCR (Qiagen Ltd) в соответствии с инструкциями производителя и секвенировали непосредственно с использованием вложенного Cβ-специфического обратного праймера (см. Выше). Секвенирование проводили капиллярным электрофорезом на секвенаторе CEQ 8000 в соответствии с инструкциями производителя (Beckman Coulter, Fullerton, CA).

    С каждым образцом было получено до 22 (обычно ~ 15) независимых последовательностей. Размер выборки (n) был выбран со ссылкой на коэффициент вариации биномиального распределения, который пропорционален 1 / √n.Это означает, что повышенная точность, полученная при увеличении размера выборки выше ∼n = 15, быстро достигает точки убывающей отдачи. Соответствующие доверительные интервалы для частот повторяющихся последовательностей были рассчитаны с использованием метода Скорректированного Вальда для биномиальных пропортино [61]. Все данные о последовательности рассматривали со ссылкой на данные, полученные с помощью анализа спектрального типа профиля длины CDR3, полученного из общей популяции исследованных клеток.

    Спектратипирование

    Для определения длин CDR3 амплифицированных продуктов ПЦР с помощью спектрального анализа проводили реакцию отвода, как описано ниже.Пять мкл очищенного продукта ПЦР инкубировали с 200 мкМ dNTP, 1 мМ MgCl 2 , 1x реакционным буфером [50 мМ KCl, 20 мМ Трис-HCl (pH 8,4)], 0,5 единиц ДНК-полимеразы Taq (Invitrogen), 1 мкл красителя WellRED D4 (Sigma), меченного вложенным Cβ-специфическим обратным праймером (5'-TCA TCT GTC CCC ACT CCT TC-3 ') при рабочей концентрации 4 мкМ в конечном реакционном объеме 20 мкл.

    Условия реакции были следующими: один цикл 95 ° C в течение 2 минут, затем 4 цикла 57 ° C в течение 2 минут и 72 ° C в течение 20 минут с использованием термоциклера G-storm (Gene Technologies, Essex, UK) или Мастерциклер Eppendorf (Eppendorf, Гамбург, Германия).Стекающие продукты реакции разбавляли в 5 раз водой, свободной от нуклеаз, и 1 мкл разбавленного продукта смешивали с 40 мкл красителя для загрузки образца (Beckman Coulter, Fullerton, CA), содержащим 0,25 мкл стандартного набора размера ДНК-600 (Beckman Coulter, Fullerton , Калифорния). Образцы переносили в 96-луночный планшет, покрывали минеральным маслом и сразу загружали в капиллярный секвенатор (CEQ8000 Genetic Analysis System, Beckman Coulter) для анализа фрагментов. Для получения оптимальных результатов образцы анализировали с использованием модифицированной программы анализа фрагментов (Frag-4), увеличивая время разделения до 75 мин.Данные были собраны в модуле анализа CEQ8000, и для каждого образца диапазон длин пар оснований продуктов был идентифицирован и отображен как профили спектрального типа. Данные о размере пика были извлечены из программного обеспечения для анализа фрагментов и перенесены в Microsoft Excel. Тесты хи-квадрат использовали для проверки того, значительно ли отличается каждое распределение длин CDR3 от распределения, полученного с неинфицированными птицами (TCRVβ1 и TCRVβ2 из несортированных клеток или клеток, положительно отсортированных по экспрессии CD4 или CD8β).Профили спектральных типов, полученные от неинфицированных птиц (n = 3 для каждой популяции), демонстрировали стабильно широкие распределения длин CDR3, которые статистически не отличались друг от друга. Эталонные распределения длин CDR3 были построены для каждой популяции путем вычисления средней доли сигнала, полученного на каждой длине CDR3 из неинфицированных образцов.

    Результаты

    Линии опухолевых клеток MD состоят из популяций моноклональных Т-клеток

    В первом случае мы выбрали восемь линий клеток, трансформированных MDV [[54], [56], [57], [62] и наши неопубликованные данные], и подвергли их анализу репертуара TCR.Трансформированная REV-T линия CD4 + Т-клеток AVOL-1 [58], [59] была включена для сравнения. Все линии опухолевых клеток MD экспрессировали исключительно Vβ1 или Vβ2, тогда как линия клеток AVOL-1, трансформированная REV-T, экспрессировала как TCR, Vβ1, так и Vβ2 (рис. 1A). Большинство случайно выбранных клеточных линий (6/7) экспрессировали Vβ1, что свидетельствует о смещении в образовании опухолей между двумя птичьими семействами TCRβ. Полученные из спектрального типа профили длины CDR3 для каждой линии MD-клеток содержали один спектральный пик, тогда как AVOL-1 содержал несколько спектральных пиков (рисунок 1B).Продукты ПЦР клонировали в вектор pCR4-TOPO, и вставки секвенировали из отдельных колоний трансформированных E.coli . Для каждой линии клеток MD все вставки содержали идентичные последовательности TCRβ CDR3, тогда как три последовательности были получены для Vβ1 в AVOL-1 (рис. 1C и S1). Взятые вместе, эти данные указывают на клональную природу клеточных линий MD по сравнению с олигоклональной структурой в трансформированной REV-T клеточной линии AVOL-1.

    Фигура 1. Клональность установленных линий клеток MDV, выявленная с помощью анализа репертуара TCRβ CDR3.

    РНК

    получали из семи клеточных линий MDV и одной REV-трансформированной клеточной линии (AVOL-1) и подвергали (A) RTPCR с продуктами, разделенными на 1% агарозном геле, и (B) спектральным анализом. Каждый образец тестировали на экспрессию TCR Vβ1 и Vβ2 со специфическими праймерами. C) Секвенирование 16 случайно выбранных клонов клеточной линии HP18 подтверждает моноклональный статус. Показаны нуклеотидные последовательности 3'-конца Vβ, целого Dβ (с модификациями нуклеотидов N и P), целого Jβ и 5'-конца Cβ (левый столбец) и транслируемых аминокислотных (аа) последовательностей (правый столбец).Для справки, верхняя последовательность (жирная) построена в конфигурации зародышевой линии с Jβ2. Все спектры значительно отличались от эталонного профиля TCRVβ1 или TCRVβ2 для несортированных клеток селезенки, полученных от неинфицированных птиц (X 2 , p <0,001).

    https://doi.org/10.1371/journal.ppat.1001337.g001

    Ограниченная клональность очевидна в опухолях MD

    Свежую опухоль яичника получали от одной птицы, инфицированной pRB-1B5 MDV (обозначенной Bird1), при вскрытии (90 DPI).Спектральный анализ выявил ограниченный репертуар TCRβ (рис. 2А) с единственным спектральным пиком для Vβ1. Профиль спектрального типа Vβ2 опухоли яичника имел два основных пика и 3 или 4 второстепенных пика. В случае Vβ1 все последовательности CDR3 были идентичными (фиг. 2В), соответствующими по размеру длине CDR3, наблюдаемой с помощью спектрального типирования, профиля, аналогичного профилю клеточных линий, полученных из опухоли. Напротив, с Vβ2 были обнаружены две повторяющиеся последовательности CDR3, одна из которых кодировала аминокислотную (аа) последовательность 'GIDSD' с частотой 9/21 последовательностей, что соответствует оценке 43% ( 95% CI 24-63 %) населения, а второй, «DRG» - 7/21 (33%, 95%, CI 17–54% населения).Остальные 5 последовательностей были синглетами. Увеличенные клоны Vβ2 могут указывать на присутствие дополнительных клонов опухоли, латентно инфицированных Т-клеток или сфокусированного Т-клеточного ответа, инфильтрирующего опухоль. Эти данные демонстрируют, что опухоль MD может состоять из моноклональной популяции Vβ1 и олигоклональной популяции Vβ2. Применение анализа спектрального типа и последовательности CDR3 к популяциям Т-клеток от неинфицированных птиц линии P выявило профили поликлонального репертуара без идентифицированной дублированной последовательности CDR3 ни в одном образце (данные не показаны).

    Рисунок 2. Ограниченный репертуар TCRβ в опухоли яичника.

    Анализ спектрального типа на РНК, выделенной из опухоли яичника от зараженной MDV птицы линии P (90 dpi с pRB-1B), A) Один спектральный пик для профиля Vβ1 (слева) и олигоклональный спектральный тип для профиля Vβ2 (справа). B) Анализ последовательности продуктов Vβ1 CDR3 (одиночный клон) и олигоклонального Vβ2 с двумя доминантными последовательностями CDR3 с частотой 43% и 33%. Показаны нуклеотидные последовательности 3'-конца Vβ, целого Dβ (с модификациями нуклеотидов N и P), целого Jβ и 5'-конца Cβ (левый столбец) и транслируемых аминокислотных (аа) последовательностей (правый столбец).Идентичность Jβ указана справа от последовательности. Для справки, верхняя последовательность (жирный шрифт) сконструирована в конфигурации зародышевой линии с Jβ3, аа последовательностями зародышевой линии для Jβ являются: Jβ1, SNMIFGDGTKLTVI; Jβ2, NVRLIFGTGTKLTVL; Jβ3, NTPLNFGQGTRLTVL; Jβ4, YVNIQYFGEGTKVTVL. Все спектры значительно отличались от эталонного профиля TCRVβ1 или TCRVβ2 для несортированных клеток селезенки, полученных от неинфицированных птиц (X 2 , p <0,001).

    https://doi.org/10.1371/journal.ppat.1001337.g002

    Доминирующие клоны в опухолях MD находятся в культивируемых клетках CD4 +

    Поскольку MDV трансформирует CD4 + клетки [9] - [12], [14], мы сравнили распределение длин CDR3 в несортированных и CD4 + популяциях клеток, полученных из опухолей. Спектральный анализ опухолей печени и почек (32 DPI) от двух дополнительных индивидуумов (обозначенных Bird 2 и 3) выявил резкое ограничение длины Vβ1 CDR3 в несортированных клетках (рис. 3, левый столбец). Эти профили были отражены спектрами популяций клеток CD4 + во всех четырех образцах опухолей (рис. 3, средний столбец).Анализ проточной цитометрии показал, что клетки CD4 + составляли 88–98% клеток, полученных из цельной опухоли (данные не показаны). Клеточные линии были созданы из трех опухолей, две из которых имели профили спектральных типов, идентичные профилям, обнаруженным в изолированных клетках CD4 + (рис. 3, правый столбец). В случае опухоли почки Bird 3 спектры CDR3 культивируемых клеток включали доминантный пик такой же длины, что и у CD4 + T-клеток, но также включали второй немного более короткий пик. Анализ последовательностей выявил доминантные последовательности, которые были обогащены путем сортировки на CD4 + клетки и ex vivo культуры , большая часть которых была получена из моноклональных расширений (рис. 4).Второй спектральный пик в культивируемых клетках Bird 3 представляет собой вторую последовательность, обнаруженную один раз в отсортированных клетках CD4 +. Более того, в результате анализа двух опухолей из разных органов у каждого индивидуума этот набор данных также продемонстрировал, что разные клоны опухоли присутствовали в разных сайтах, причем каждый сайт доминировал в одном клоне Vβ1 (например, последовательности аа CDR3 EWDRGTY и VGGDRLS для Bird 2).

    Рис. 3. Доминирующие длины CDR3, идентифицированные в опухолях, присутствуют в отсортированных клетках CD4 + и культивируемых клетках.

    TCRVβ1 Распределение длины CDR3 (спектральный тип) в несортированных (левый столбец) и CD4 + популяциях клеток, полученных из опухолей (средний столбец), и клеточных линий, полученных из трех опухолей (правый столбец). Образцы, полученные из печени и почек двух птиц линии P 32dpi с RB-1B MDV. Данные показывают, что доминирующие спектральные пики в опухолях MDV лежат в трансформированной популяции клеток CD4 +. Все спектры значительно отличались от эталонных профилей для несортированных или CD4 + клеток селезенки, полученных от неинфицированных птиц (X 2 , p <0.001).

    https://doi.org/10.1371/journal.ppat.1001337.g003

    Рисунок 4. Идентичность CDR3-последовательности TCRVβ1 подтверждает клональную идентичность Т-клеток в опухолевых CD4 + и культивируемых клетках.

    Аминокислотные последовательности CDR3

    , полученные путем трансляции in silico нуклеотидных последовательностей CDR3, ассоциированных с TCRVβ1. Образцы, полученные из печени и почек двух птиц линии P 32 dpi с RB-1B MDV, представляют собой несортированные опухоли (левый столбец) и популяции CD4 + клеток, полученных из опухолей (средний столбец), и клеточные линии, полученные из трех опухолей (правый столбец).Каждая последовательность происходит из клонированного продукта RTPCR, выбранного из отдельных трансформированных колоний E. coli . Для справки, верхняя последовательность (жирный шрифт) сконструирована в конфигурации зародышевой линии с Jβ3, аа последовательностями зародышевой линии для Jβ являются: Jβ1, SNMIFGDGTKLTVI; Jβ2, NVRLIFGTGTKLTVL; Jβ3, NTPLNFGQGTRLTVL; Jβ4, YVNIQYFGEGTKVTVL. Данные подтверждают клональную идентичность между опухолями MDV и культивируемыми клетками CD4 +, как предполагает анализ спектрального типа.

    https://doi.org/10.1371/journal.ppat.1001337.g004

    В отличие от Vβ1, профили спектрального типа Vβ2 4 опухолей (Рисунок S2) и соответствующие последовательности (Рисунок S3) указывают на более широкий репертуар, хотя относительно большие клоны CD4 + Т-клеток были обнаружены в печени Bird 2 и почка. Однако ни один из этих клонов не может быть получен в трансформированных линиях Т-клеток и может представлять собой некультивируемые опухоли или сфокусированный ответ Т-клеток. Чтобы определить частоту профилей, соответствующих метастатическим опухолевым клонам (общие клоны в нескольких участках) и клонам с независимым происхождением (разные клоны), мы провели анализ спектрального типа нескольких участков опухоли от следующих семи птиц (птицы с 4 по 10).Профили, полученные как для Vβ1, так и для Vβ2, показаны на рисунке S4 (A для Vβ1 и B для Vβ2). Доминирующие спектральные пики, общие для нескольких участков, были обнаружены у 6 из 7 птиц, но у большинства особей наблюдались также завышенные спектральные пики, характерные для участков, например, в почке Vβ1 птицы 7. В целом, данные указывают на большую систематическую ошибку в профиле. длины CDR3 во всех участках опухоли (p <0,001), а общие пики между участками часто связаны с общей последовательностью CDR3. Однако, как видно на примере Bird 2, иногда последовательность будет отличаться, несмотря на общую длину CDR3 (фиг. 4).Интересно, что доминирующий спектральный пик, наблюдаемый в нескольких участках опухоли, часто был очевиден в образцах селезенки и / или крови, что подтверждает интерпретацию метастатического распространения некоторых клонов опухоли.

    Дальнейшие анализы спектрального типа и секвенирования были выполнены для определения природы ответа CD8 + (см. Ниже), где клетки из нескольких опухолевых участков были разделены на фракции CD4 и CD8. Профили спектральных типов для всей опухоли или отсортированных CD4 + клеток из опухолевых участков у птиц 11–14 были аналогичны профилям, наблюдаемым для птиц 1–10, с доминирующими спектральными пиками в участках опухоли (рис. S5).Некоторые из доминирующих пиков были общими для участков опухоли у одной птицы, в то время как другие были специфичными для определенных участков. Продукты Vβ1 и Vβ2 секвенировали для всех участков опухоли у птиц 11 и 12 (фигуры с S6 по S9). В отсутствие культивируемых линий Т-клеток, полученных из этих опухолей, мы предварительно определили опухолевидные клоны как обогащенные CD4 и представляющие более 30% последовательностей в любом одном сайте (большинство из них имели гораздо более высокую частоту, чем 30%). В частности, данные последовательности для Vβ1 в CD4 + клетках птицы 11 (фиг. S6) идентифицируют три больших опухолевидных клона: «LDGTGGY» (только печень), «RRLTGD» (почка и как синглет в яичнике) и «LDTGGS» ( печень, почки и яичники).Последовательность для Vβ2 в CD4 + клетках Bird 11 (фигура S7) выявила одну сильно представленную последовательность во всех сайтах (ILRDRGW), которая может представлять метастатическую опухоль, и вторую в селезенке (IRLGTGGY). Для Bird 12 (фигура S8) ни один Vβ1 CDR3 не был представлен более чем на 30% последовательностей, полученных из CD4 + Т-клеток, но одна последовательность Vβ2 (фигура S9) с мотивом CDR3 «QG» была доминирующей в почках (18/19 CD4 + последовательностей) и обнаруживается в яичниках и селезенке. Вторая последовательность CD4 +, Vβ2 CDR3 «FVMRGID» доминировала в яичнике, но нигде не обнаруживалась.

    У большинства людей метод секвенирования выявил более мелкие клоны CD4 + клеток (повторяющиеся, но <30% последовательностей в любом сайте), включая Vβ1 с птицами 2, 11 и 12 и Vβ2 с птицами 3, 11 и 12 (рисунки 4, S3, От S6 до S). Эти последовательности могут также представлять небольшие клоны опухоли или отвечающие клетки, но распространение одной из этих последовательностей в культивируемых клетках из почек Bird 3 указывает на то, что объяснение «клон малой опухоли» действительно. Глобальное отнесение меньших клонов CD4 Т-клеток к ответу или опухолевому фенотипу невозможно с текущими наборами данных.Тем не менее, наши данные ясно продемонстрировали, что в культивируемых опухолях обычно преобладает один клон Т-клеток, но что разные участки в пределах одного человека могут содержать независимые клоны опухоли.

    Крупные клоны опухоли могут быть идентифицированы в крови птиц, инфицированных MDV

    Обнаружение опухолевых клонов в крови при вскрытии повысило возможность идентификации опухолевых клонов до появления явного заболевания. Первоначальный анализ образцов крови, собранных примерно за 2 недели до появления у птиц клинических признаков, подтвердил мнение о том, что спектральный тип TCR может быть полезен для обнаружения клонов опухоли, циркулирующих в крови.Результаты анализа Vβ1 лейкоцитов периферической крови (PBL) для двух птиц (Bird 15 и 16) представлены на рисунке 5. Образцы печени, почек, мышц, сердца и селезенки, взятые при 49 DPI у Bird 15, выявили доминантный спектральный пик, который также можно было обнаружить в крови при 42 и 35 DPI (что привело к значительному смещению спектрального профиля; p <0,001). Точно так же Bird 16 имел одинаковый спектральный пик в печени, почках и яичниках с чрезмерно представленным пиком и смещенным профилем CDR3 в крови при 35 DPI (p <0.001), за неделю до начала клинического заболевания. У Bird 16 также был второй спектральный пик в яичнике и не общий спектральный пик в мышце, которые не были обнаружены в крови.

    Рис. 5. Спектральный анализ показал, что клоны опухоли можно идентифицировать в крови птиц, инфицированных MDV.

    TCRVβ1 Распределение длины CDR3 опухоли, селезенки и лимфоцитов периферической крови (PBL) от птицы 15 (левый столбец) и птицы 16 (правый столбец). Образцы опухоли и селезенки были взяты при вскрытии (49 точек на дюйм с RB1B MDV) и образцы PBL при 27 и 35 точек на дюйм.Доминирующие спектральные пики могут быть обнаружены в крови при 35 DPI, что соответствует профилям опухоли, которые содержат ожидаемые доминантные спектральные пики. Распределение спектральных типов образцов сравнивали с эталонными профилями TCRVβ1 или TCRVβ2 для несортированных или CD4 + клеток селезенки, полученных от неинфицированных птиц с помощью анализа X 2 ; статистическая значимость указана для каждой панели. NS = не значимо (при p> 0,05). Ли, печень; Kd, почка; Ov, яичник; Spl, селезенка; Musl, мышца; Hrt, сердце; PBL, лимфоциты периферической крови.

    https://doi.org/10.1371/journal.ppat.1001337.g005

    Еще у двух птиц (17 и 18) брали пробы крови серийно (два раза в неделю) на протяжении всей инфекции для более точного обнаружения клонов опухоли в крови. , а результаты для спектров Vβ1 и Vβ2 изображены на Фигуре 6. Профиль опухоли Bird 17 при вскрытии (33 DPI) указывает на общий спектральный профиль для Vβ1 в почках, семенниках и селезенке (и в клетках CD4 +, выделенных из почек). и селезенка) и второй сайт-рестриктированной опухоли в почке, содержащей клетки CD4 + Vβ2 +.Спектральная длина CDR3 многосайтовой опухоли легко определялась в PBL из 16 DPI (p <0,01, а в более поздние моменты времени p <0,001), тогда как более ранние образцы PBL демонстрировали «нормальное» распределение длин CDR3, которое существенно не отличалось от спектральные профили, полученные от незараженных птиц. Напротив, сайт-специфическая опухоль Vβ2 не была обнаружена как смещение спектрального типа в PBL в любое время. Профили опухолей Bird 18 выявили один общий сайт (яичник и селезенку) Vβ1 опухоли, один единственный сайт опухоли Vβ1 (печень) и один общий сайт опухоли Vβ2 во всех трех участках (хотя более сложный спектр опухоли яичников предполагает, что он может быть менее высоким). представлены).Многосайтовая опухоль Vβ1 была обнаружена как спектральное смещение в PBL между 16 и 19 DPI (p <0,001), хотя общее смещение было менее значительным, чем у Bird 17.

    Рис. 6. Раннее появление клонов метастатической опухоли в крови птиц, инфицированных вирусом лейкоцитов.

    TCRVβ1 и TCRVβ2, распределение длин CDR3 образцов, полученных из B17 (левые столбцы) и B18 (правые столбцы). Лимфоциты периферической крови (PBL) выделяли из образцов, взятых во время инфицирования опухолью, образцов селезенки и PBL, взятых при вскрытии.Некоторые образцы опухоли и селезенки были подвергнуты положительному обогащению CD4 + Т-клетками с помощью сортировки с помощью магнитных шариков. Доминирующие спектральные пики, связанные с опухолью, могут быть обнаружены в PBL на ранних стадиях инфекции (например, птица 17 Vβ1 при 16 DPI). Распределение спектральных типов образцов сравнивали с эталонными профилями TCRVβ1 или TCRVβ2 для несортированных или CD4 + клеток селезенки, полученных от неинфицированных птиц с помощью анализа X 2 ; статистическая значимость указана для каждой панели. NS = не значимо (при p> 0.05). Ли, печень; Kd, почка, Tes, семенники, Ov, яичник; Spl, селезенка; PBL, лимфоциты периферической крови.

    https://doi.org/10.1371/journal.ppat.1001337.g006

    Спектральные профили PBL от птиц, инфицированных MDV, показывают, что клоны мультисайтовых опухолей могут быть легко обнаружены в крови за две недели до появления клинических симптомов. В отличие от многосайтовых опухолей, опухоли, ограниченные одним участком, не обнаруживались в крови. Появление клонов опухоли в крови повлияло на репертуар всей популяции PBL, особенно внутри семейства TCRVβ, составляющих опухоль (например,г. для Bird 17 профиль Vβ1 в крови полностью определялся опухолью). Более того, нарушение, вызванное большим клоном опухоли CD4 + Т-клеток в Vβ1, также повлияло на профиль репертуара Vβ2 (сравните профили спектрального типа до и после 12 DPI) со значительно измененными профилями длины CDR3 в PBL Bird 17 при 16 DPI. (p <0,005), 29 точек на дюйм и 33 точек на дюйм (оба p <0,001).

    Опухоли MD содержат популяции высокофокусированных клеток CD8 +

    Хотя природа опухоли затрудняет идентификацию ответа CD4 + Т-клеток, CD8 + TCRαβ + Т-клетки явно представляют собой отвечающую популяцию Т-клеток, способную к специфическому распознаванию, продукции цитокинов и способности противостоять MDV [38], [39], [63] .Более того, у людей, инфицированных персистирующими вирусами (например, EBV, CMV и HTLV), отвечающие CD8 + Т-клетки развивают высокофокусированный репертуар [2], [41] - [43], [64], [65]. Следовательно, для определения репертуара ответа CD8 + у птиц, инфицированных MDV, мы выделили популяции CD8 + Т-клеток из ряда опухолевых участков и подвергли их анализу репертуара на основе спектрального типа и последовательности (одновременный анализ популяций CD4 + использовался для определения природы заболевания). профили опухолей у этих людей (Рисунки S5, S6, S7, S8 и S9).

    Профили спектральных типов, полученные для анализа репертуара Vβ для клеток CD8 +, выделенных из множества опухолевых участков у четырех птиц (от 11 до 14), представлены на рисунке 7. Клетки CD8 + представляли меньшую популяцию клеток в опухоли, в пределах от 0,4 до 5% по данным проточной цитометрии. анализ (данные не показаны). Высокоочищенные клетки CD8 + (> 99%) демонстрировали ограниченный спектральный профиль длины Vβ1 CDR3 (p <0,001; фигура 7). Внутри птиц спектральные профили, взятые из разных участков, часто включали общие пики, обнаруженные в нескольких образцах.Спектральные профили Vβ2 были более вариабельными, но также были характерны для смещенных популяций (от p <0,01 до p <0,001) с большими чрезмерно представленными пиками в некоторых образцах. Продукты Vβ1 были субклонированы и секвенированы со всех сайтов у двух птиц (11 и 12) (фиг. 8), что позволило идентифицировать клональную экспансию по присутствию повторяющихся последовательностей. Эти последовательности включали мотив "GGS" CDR3 aa, присутствующий как в Bird 11, так и в 12, в виде большой, многосайтовой, чрезмерно представленной "общедоступной" последовательности CDR3. Учитывая, что этот клон был единственной последовательностью такой длины в Bird 11 или 12, любопытно, что этот спектральный пик также был чрезмерно представлен в CD8 + T-клетках от Bird 13 и 14.Другие повторяющиеся последовательности CDR3 в CD8 + Т-клетках включали «RDRGIY» (в печени, почках и селезенке), «SRTGGS» (яичник и селезенка) и «IFGIY» (селезенка) Bird 11 и «GGSI» в селезенке Bird 12. Далее Последовательности-кандидаты CD8 + CDR3 были идентифицированы как присутствующие в несортированных популяциях и не присутствующие в отсортированных по CD4 + популяциях. К ним относятся те, которые были выявлены попытками секвенирования Vβ2; два из Bird 2 (ETGGVY и FAFIDRGI), один из Bird 3 (TIERVD), два из Bird 11 (EVGEILY и TTPQGDRSQ) и один из Bird 12 (RGGYQPA).

    Рис. 7. Репертуар отвечающих CD8 + Т-клеток сильно сосредоточен на участках опухоли и селезенке.

    Представлены спектры транскриптов TCR Vβ1 и Vβ2 из магнитно-отсортированных клеток CD8 +, полученных из множественных опухолевых участков четырех птиц (птицы 11–14). Профили показывают искаженное распределение, очевидное во всех участках опухолей как в Vβ1, так и в Vβ2, причем некоторые из них являются общими для разных опухолей в пределах одного хозяина, некоторые из которых также наблюдаются в селезенке. Этих птиц также исследовали на клональность опухоли CD4 + по спектральному типу (фиг. S6) и последовательности CDR3 (фиг. S7), которые выявили комбинацию общих и сайт-специфичных клонов опухоли.Распределения спектральных типов образцов сравнивали с эталонными профилями TCRVβ1 или TCRVβ2 из клеток селезенки CD8β +, полученных от неинфицированных птиц с помощью анализа X 2 ; статистическая значимость указана для каждой панели. NS = не значимо (при p> 0,05). Ли, печень; Kd, почка; Ov, яичник; Spl, селезенка.

    https://doi.org/10.1371/journal.ppat.1001337.g007

    Рис. 8. Частные и общедоступные CDR3-последовательности в CD8 + Т-клетках, происходящие из множественных участков опухоли и селезенки.

    аминокислотных последовательностей CDR3, полученных с помощью in silico. трансляция нуклеотидных последовательностей TCRβ CDR3 для TCRVβ1 и: TCRVβ2. Образцы, полученные от птицы 11 и птицы 12, магнитно-отсортированных CD8 + клеток (чистота> 99%) из множества опухолевых участков и селезенки. Каждая последовательность происходит из клонированного продукта RTPCR, выбранного из отдельных трансформированных колоний E. coli . Выравнивания производят с областями TCRVβ и Jβ, где возможные остатки последовательности Dβ также используются для выравнивания.Для простоты верхняя последовательность (жирная) получена в результате трансляции геномной конформации Vβ, Dβ и Jβ3. Трансляция геномных последовательностей сегментов Jβ выглядит следующим образом: Jβ1, SNMIFGDGTKLTVI; Jβ2, NVRLIFGTGTKLTVL; Jβ3, NTPLNFGQGTRLTVL; Jβ4, YVNIQYFGEGTKVTVL: данные демонстрируют клональную структуру в популяциях CD8 + Т-клеток с общими клонами между сайтами и общедоступной последовательностью CDR3 TCRVβ1, общей для разных индивидуумов.

    https://doi.org/10.1371/journal.ppat.1001337.g008

    В совокупности эти результаты указывают на высокофокусированный ответ CD8 + Т-клеток с некоторыми клонами, присутствующими с высокой частотой во множественных опухолевых участках и селезенке. Профиль опухоли Bird 11 (5 опухолевидных клонов с двумя метастазами) и Bird 12 (2 опухолевидных клона с одним метастатическим и одним ограниченным яичниками) может иметь отношение к идентичности разрастаний CD8 + Т-клеток, наблюдаемых в разных сайтах. . Например, общедоступная последовательность CDR3 GSS была обнаружена в большинстве участков опухоли, тогда как некоторые другие клоны CD8 + были более ограничены в своем распространении в определенных местах.

    Основываясь на предположении об аналогичных уровнях мРНК TCR во всех клетках и известном количестве клеток Vβ1 + и Vβ2 + CD8 + в опухоли и селезенке, мы можем оценить размер клонов CD8 + в месте опухоли и селезенке. Например, в Bird 11 популяция селезенки трех клонов CD8 + Vβ1 + «GGS», «RDRGIY» и «IFGIY», каждый, представляла 12,5% CDR3, что переводится в популяции из ~ 25 миллионов клеток ( 95% CI 4– 74 × 10 6 ). У Bird 12 общедоступная последовательность аминокислот CDR3 «GGS» присутствовала в 6/22 (27%) последовательностях CDR3 из CD8 + Т-клеток, представляющих ~ 54 миллиона клеток ( 95% ДИ 24– 96 × 10 6 ) и частный «GGSI», представленный в ∼27.2 миллиона клеток ( 95% ДИ 8–72 × 10 6 ).

    Сводка CDR3, идентифицированных у птиц, инфицированных MDV, или линий клеток, трансформированных MDV

    Для целей сравнения мы отобразили идентичность всех избыточно представленных последовательностей CDR3, идентифицированных в этом исследовании, и сгруппировали их в соответствии с частотой в различных подмножествах Т-клеток (Рисунок 9). Все клеточные линии содержали моноклональные последовательности CDR3, за исключением одной краткосрочной культивированной клеточной линии, которая была биклональной. В CD4 + Т-клетках, полученных из участков опухоли, было идентифицировано четырнадцать высокочастотных CDR3 (> 50%), причем десять представлены более чем на 70% полученных последовательностей.Из 21 «высокочастотного» CDR3 (установленные клеточные линии, клетки, культивируемые ex vivo и опухолевые участки), они были распределены в CDR3 на основе Vβ1 и Vβ2 (13 и 8 соответственно). Были представлены все четыре сегмента Jβ. Другие CD4 + CDR3 присутствовали от 10 до 30% с небольшим количеством низкочастотных (<10%) повторяющихся последовательностей. В положительно отсортированных популяциях CD8 или не-CD4 (предположительно CD8 +) были обнаружены некоторые большие клоны, большинство из которых представляли частные CDR3, но один представлял общедоступную последовательность CDR3, обнаруженную у нескольких птиц.Образцы Т-клеток от неинфицированных птиц были поликлональными (без повторяющихся CDR3), и ни один из CDR3, обнаруженных у птиц, инфицированных MDV, не был обнаружен (данные не показаны).

    Фигура 9. Краткое изложение CDR3, идентифицированного у птиц, инфицированных MDV, или линий клеток, трансформированных MDV.

    Последовательности CDR3 сгруппированы в соответствии с использованием Vβ и частотой, обнаруженной в образцах, и / или способностью расти in vitro (L = устоявшаяся клеточная линия; C = новая клеточная линия; C * = новая клеточная линия из небольшого in vivo. клон).** Последовательности CDR3, обнаруженные на частотах> 70% выбранных последовательностей. Все данные извлечены из последовательностей, представленных на рисунках 1, 2, 4, 7, S1, S3 и S6 – S9. Для сравнения дана конфигурация зародышевой линии последовательности Vβ-Dβ-Jβ3Cβ. Трансляция геномных последовательностей сегментов Jβ выглядит следующим образом: Jβ1, SNMIFGDGTKLTVI; Jβ2, NVRLIFGTGTKLTVL; Jβ3, NTPLNFGQGTRLTVL; Jβ4, YVNIQYFGEGTKVTVL .: Идентичность каждого Jβ указывается справа от каждой последовательности.

    https://doi.org/10.1371 / journal.ppat.1001337.g009

    Обсуждение

    Трансформация лимфоидных клеток, управляемая вирусами, является основным клиническим последствием инфицирования людей стойкими инфекциями, такими как EBV и HTLV. Прогрессу в понимании этих болезней человека препятствует отсутствие подходящих модельных систем. MDV представляет собой естественный альфа-герпесвирус галлиформных птиц, способный вызывать быстрое развитие опухолей у восприимчивых птиц. Убытки, вызванные этой группой вирусов, также представляют собой серьезную проблему сами по себе; без вакцинации против MDV птицеводство было бы неустойчивым.Действительно, способность вакцинировать против образования опухолей MDV имеет значение для контроля над опухолями, имеющими медицинское значение [1], [6]. В рамках этой концепции мы рассмотрели вопрос клональности Т-клеток во время инфекции и образования опухоли, рассекая опухоль, селезенку и кровь для выявления изменений репертуара трансформированных клеток CD4 + и отвечающих клеток CD8 +. С MD почти все клеточные линии и опухоли in vivo были охарактеризованы как CD4 +, [9] - [11], [13], [14]. В одном исследовании с использованием внутрибрюшинного пути инфицирования одной из двенадцати клеточных линий была CD4- CD8α +, но в ней отсутствовала экспрессия CD8β [12].Все образцы CD8 + в этом исследовании были приготовлены с использованием анти-CD8β, чтобы избежать выделения неклассических CD8αα Т-клеток. Мы решили изучить профили Vβ как меру клональности, поскольку этот рецептор клонально экспрессируется с единственной последовательностью в рамке считывания, присутствующей в каждом клоне Т-клеток из-за процесса исключения аллелей, который имеет место во время развития Т-клеток в тимусе [ 66] - [68].

    Клональность опухоли - фундаментальная проблема патогенеза МД. Инфекционный цикл включает перенос вируса из легких, чтобы инициировать цитолитическую инфекцию в В-клетках.Это сопровождается распространением и литическим циклом инфекции в основном в популяции Т-лимфоцитов CD4 TCRαβ до развития латентной инфекции и передачи MDV в эпителий перьевых фолликулов, откуда распространяется инфекционный вирус [8]. У всех инфицированных птиц наблюдается стойкая латентная инфекция, а у восприимчивых птиц обычно развиваются опухоли в течение 4–5 недель. В этом и заключается проблема; если событие трансформации встречается редко, как объяснить высокую пенетрантность и временную воспроизводимость фенотипа опухоли, если только «опухоли» не индуцируются в результате поликлональной трансформации.Предыдущие исследования рассматривали этот вопрос в отношении характера геномной интеграции MDV в геном клетки-хозяина [18], [19] или путем окрашивания клеточной поверхности CD30 в качестве маркера, ассоциированного с опухолью [10]. Эти два исследования пришли к противоположным выводам: ограниченные профили интеграции MDV, использованные для предположения клональных опухолей (с метастазами), в отличие от высокой экспрессии CD30 в обоих TCRαβ-семействах в пределах одной опухоли, использовались для предположения поликлональности. Наши исследования с использованием методов анализа репертуара TCRVβ [45] в качестве независимого от вирусной интеграции клонального «штрих-кода» для идентификации репертуара CD4 + TCRαβ + Т-клеток в линиях опухолевых клеток и на образцах опухолей, полученных из in vivo и , выявили характерные особенности клональное доминирование в олигоклональной структуре опухолевых CD4 + Т-клеток.

    Все установленные клеточные линии, происходящие из опухоли, были моноклональными (каждая экспрессировала одну последовательность TCRβ CDR3), хотя одна краткосрочная линия, полученная в ходе этих исследований, была биклональной при втором пассаже. Напротив, трансформированная REV-T клеточная линия AVOL-1 была олигоклональной после более чем 37 пассажей, экспрессирующих по меньшей мере три последовательности TCRVβ1 и одну Vβ2 TCR CDR3 последовательности. Профили спектральных типов, полученные со всеми линиями клеток, были диагностическими с точки зрения клональности CDR3, как определено анализом последовательности.Клональная структура клеточных линий не зависела от продолжительности культивирования, что позволяет предположить, что моноклональность не является артефактом отбора in vitro в результате множественных пассажей. Следовательно, вероятно, что отбор доминантных трансформированных клонов уже произошел in vivo и сохраняется в клеточных линиях MDV, как предполагалось ранее [19]. Кроме того, клеточные линии, полученные в этом исследовании из свежих опухолей, экспрессировали идентичность TCR, аналогичную исходной опухоли in vivo .В тех случаях, когда клеточные линии были установлены больше всего (~ 90%), экспрессировали семейство Vβ1 Т-клеточных рецепторов только с одним, экспрессирующим Vβ2, соотношение согласуется с ошибкой 84%, о которой ранее сообщалось [13].

    В профиле большинства первичных опухолей доминировал единственный клон трансформированных Т-клеток, хотя биклональное преобладание в отдельных опухолевых участках не было редкостью. Однако анализ последовательности выявил более мелкие вторичные клоны увеличенных CD4 + Т-клеток в большинстве опухолей (~ 10% последовательностей CDR3), и рост одного из них во время культивирования ex vivo указывает на опухолевый потенциал субдоминантных клонов CD4 +.Некоторые из очень больших клональных популяций также не смогли стать линиями опухолевых клеток ex vivo , что, возможно, указывает на фенотипическую изменчивость в состоянии трансформации. Действительно, учитывая очень большие клоны TCR (от 40 до 100% CD4 + CDR3 в одном сайте), они были равномерно распределены между TCRVβ1 (9 последовательностей) и TCRVβ2 (8 последовательностей) (Фиг.9). Ошибка в использовании TCRVβ в клеточных линиях может представлять артефакт культивирования или отражать биологию клеток, экспрессирующих различных членов семейства TCR.Тем не менее, многоэтапный анализ доминантного CDR3 в первичной опухоли, в отсортированных клетках CD4 + и после создания линий лимфобластоидных клеток ex vivo важен для подтверждения способности идентифицированных больших клонов выражать способность опухоли. Все четыре сегмента Jβ присутствовали в CDR3 как TCRVβ1, так и TCRVβ2, экспрессирующих большие опухолевидные клоны, или в культивируемых линиях опухолевых клеток.

    Наши данные решают многие проблемы, связанные с клональностью опухоли MD. По сути, мы демонстрируем клональное доминирование в опухолях MD (в целом аналогично тому, о котором сообщали Delacluse et al., [19]), хотя наш независимый от сайтов интеграции анализ с использованием CDR3 области Т-клеточного рецептора выявил более сложный клональный каркас внутри и между сайтами опухоли in vivo . На разных участках опухоли у одного человека могут преобладать общие или разные клоны, следовательно, один человек может испытывать несколько событий трансформации, приводящих к опухолям, которые имеют очень разные характеристики. В большинстве случаев доминантный клон in vivo, присутствующий в конкретном сайте, был единственным клоном, представленным в линиях культивированных клеток ex vivo , выращенных в условиях культивирования опухолей.Однако в одном случае один из клонов с более низкой частотой проявлял опухолевидные паттерны роста ex vivo (наряду с доминантным клоном в исходном сайте), указывая на то, что некоторые из более мелких клонов существуют в состоянии, способном к трансформации. Тот факт, что многие люди являются носителями как метастатических, так и одноцентровых опухолевых клонов, указывает на сложное взаимодействие между трансформацией и клональной конкуренцией. Действительно, у большинства людей общая опухолевая нагрузка была результатом небольшого количества независимых событий трансформации (т.е. более одного, но менее 3 или 4). Напротив, у некоторых людей множественные опухоли были результатом метастазирования из одного клона опухоли. Заслуживает внимания взаимосвязь между этими «успешными» клонами опухоли и популяцией инфицированных клеток.

    В более широком контексте, моноклональное происхождение Т-клеточного лейкоза / лимфомы взрослых (ATLL), вызванного злокачественными новообразованиями, связанными с человеческим Т-лимфотропным вирусом типа -1 (HTLV-1), хорошо задокументировано [2], [69], [ 70]. Этот профиль, вероятно, связан с редкостью ATLL даже среди серопозитивных людей по HTLV-1 [3], что отражает приобретение вторичных геномных повреждений в постоянно инфицированных Т-клетках.Тем не менее, быстрое развитие MD-опухолей с клональным доминированием в контексте более сложной структуры олигоклональной экспансии может также отражать обстоятельства, общие для других связанных с опухолью персистентных вирусов лимфоцитов, включая HTLV-1. Возможно, основные различия могут заключаться в силе индуцированной MDV репликации Т-клеток, приводящей к сжатым временным рамкам по сравнению с другими лимфотропными, ассоциированными с опухолью вирусами.

    Биологические различия были также обнаружены среди очень больших клональных CD4 + «опухолей», при этом некоторые клоны были обнаружены в нескольких местах, включая кровь и селезенку, тогда как другие были расположены в одном месте, что указывает на фенотипическое разнообразие, основанное на метастатической способности.Идентификация метастатических клонов опухоли в крови позволила провести серийный анализ образцов крови инфицированных птиц, чтобы определить динамику появления клона опухоли в зависимости от времени заражения и появления клинических признаков. Спектральный анализ образцов крови до заражения и в первые 10–14 дней выявил профиль, соответствующий поликлональной популяции циркулирующих клеток. Однако в некоторых случаях «опухолеспецифическая» характеристика спектрального типа может быть обнаружена в крови от 12 до 16 точек на дюйм, более чем за две недели до появления клинических признаков.Появление опухолевого клона на обнаруживаемых уровнях в крови подтверждает предположение о раннем событии трансформации. Уровень распространения опухолевых клонов в компартменте крови в начале клинического заболевания был экстремальным, и у некоторых людей это были единственные обнаруживаемые клоны Т-клеток (например, в TCRVβ1 для птиц 15 и 17), представляющих опухоль (рис. 5 и 6). . Также были доказательства нарушения поликлонального репертуара в клетках, экспрессирующих TCRVβ2 (фиг. 6), что позволяет предположить, что ниша в крови для Т-клеток заполнялась опухолью.Следовательно, учитывая, что в профиле циркулирующего TCR преобладает один клон, неудивительно, что у птиц, инфицированных MDV, развивается иммунодефицит [см. Обзор [71]]. Эти драматические изменения репертуара будут иметь большее влияние, чем сообщаемые изменения в продукции цитокинов [72], и будут иметь иммунологически катастрофические последствия. Инфильтрация кожи CD4 + Т-клетками является следствием инфекции MDV [73], [74] [75], и высокочастотные клоны опухоли в крови, вероятно, представляют перемещение MDV к месту передачи.

    У млекопитающих многие стойкие вирусные инфекции, включая EBV, CMV и HTLV, стимулируют высокофокусированное расширение репертуара отвечающих CD8 + Т-клеток [2], [76], [77]. Хотя опухоли MDV были заселены относительно небольшим количеством CD8 + Т-клеток, их репертуар был высокоструктурированным и олигоклональным по своей природе. Размеры клонов CD8 + Т-клеток, составляющие от 25 до 50 миллионов клеток, аналогичны тем, о которых сообщалось при стойких вирусных инфекциях у людей [78]. Однако в случае MD они развиваются в течение гораздо более короткого периода времени, чем считается в случае инфекций млекопитающих.Например, если принять консервативную оценку пролонгированного деления Т-клеток в 12 часов / деление [79] и предположить отсутствие гибели клеток (маловероятно), самая поздняя временная точка для начальной стимуляции CD8 + Т-клеток будет примерно за 15 дней до отбора образцов. Этот расчет поместил бы инициацию этих клонов специфических CD8 + Т-клеток на ~ 15 DPI, вероятно, раньше, примерно в то время, когда была инициирована скрытая инфекция. Быстрое фокусирование и клональное расширение репертуара, специфичного для MDV, предполагает ограничение небольшим набором антигенов MDV.Действительно, Омар и Шат [38] исследовали цитолитический ответ инфицированных птиц против панели клеточных линий, экспрессирующих отдельные гены MDV, обнаружили, что у птиц гомозиготной линии P 2a MHC B 19 цитолитическая активность ограничивалась meq, Антигены gB и pp38, тогда как у птиц генетически устойчивой линии N 2a (B 21 ) также были обнаружены антигены ICP4. В наших исследованиях инфильтрирующие опухоль CD8 + Т-клетки продуцируют более высокие уровни мРНК IFNγ, чем CD8 + Т-клетки, полученные из селезенки неинфицированных птиц (неопубликованные данные, Mwangi, Peroval et al.,). CD8 + Т-клеточный ответ восприимчивых птиц недостаточен для предотвращения прогрессирования опухоли; наши данные обеспечивают основу для сравнения с устойчивыми или вакцинированными птицами, у которых не развиваются опухоли. Наш анализ последовательности четко обнаружил большие клоны CD8 + Т-клеток и позволил приблизительно определить размер клона. Применение технологий секвенирования с более высокой пропускной способностью может быть полезным в будущем для выявления более мелких клональных экспансий и обеспечения более точных оценок размеров клонов. Понимание природы репертуара TCR к конкретным антигенам после инфицирования и вакцинации может быть использовано для улучшения подходов к вакцинам в будущем.Быстрый характер фокусировки в популяции CD8 + может отражать комбинацию минимальной конфигурации MHC, где каждый гаплотип доминирует благодаря презентации через один ген MHC класса I [80] и минимальный локус TCRVβ с 13 сегментами Vβ всего в двух семьях [45]. ].

    Высокочастотные клоны CD8 + Т-клеток были обнаружены как в опухолевых сайтах, так и в селезенке инфицированных людей, либо ограничены одним опухолевым сайтом, либо присутствуют в нескольких опухолевых сайтах. Один из крупнейших клонов CD8 + имеет примечательную последовательность CDR3 («GSS»), поскольку идентичные последовательности были обнаружены у разных людей.Этот тип CDR3 известен как «публичная» реаранжировка TCR и, хотя ранее сообщалось о млекопитающих, встречается относительно редко [81]. При более близком рассмотрении стало ясно, что общедоступная аминокислотная последовательность GSS для CDR3 также представляет собой общую нуклеотидную последовательность у разных людей. Интересно, что последовательность GSS представляет собой сохранение фрагмента сегмента D после делеции шести нуклеотидов в сегменте D и трех нуклеотидов в сегменте Vβ1. Хотя ранее это не отмечалось, ясно, что CDR3, созданный путем делеции (без добавления оставшихся нуклеотидов), с гораздо большей вероятностью встречается у нескольких индивидуумов, чем CDR3, созданный путем добавления нуклеотидов.Мы предполагаем, что общедоступные последовательности CDR3 в других контекстах (например, у людей) также могут соответствовать этому устройству, представляя модификацию соединения на основе делеций. Эта функция может быть полезна и использоваться в различных сценариях для улучшения «общественного» ответа на вакцины. Остальные последовательности CDR3, положительно идентифицированные как клональные расширения в клетках CD8 + (или как не в клетках CD4 +), все представляли «частные» идентичности CDR3 (фиг.9).

    В этом отчете мы задокументировали изменения репертуара TCR Vβ, связанные с инфекцией, развитием опухоли и противоопухолевым ответом, которые характеризуют патогенез MDV.Рассмотрев наши данные в контексте предыдущих отчетов, мы предполагаем, что в опухолях MD преобладает клональная экспансия в олигоклональной структуре минорных клонов предраковых клеток. Мы предполагаем, что этот тип популяционной структуры объясняет пенетрантность и узкое временное окно, которые характеризуют MD у восприимчивых птиц. Анализ CDR3 выявил, что все установленные линии клеток, трансформированные MDV, были клональными (с одной биклональной краткосрочной культурой), и что эти клоны представляют собой доминантные клоны, обнаруженные in vivo .Внутри птиц с множественными опухолями наблюдалась смесь метастатических и сайт-специфических клонов опухолей. В целом мы исследовали 50 опухолей, полученных от 21 человека, и во всех опухолях преобладали один или два клона, причем некоторые птицы имели один клон метастатической опухоли, а другие - разные клоны в разных местах. Система анализа репертуара TCR позволила изучить различные области биологии MD лимфомы и ответ CD8 + на инфекцию. Мы считаем, что этот тип подхода может быть использован для дальнейшего определения патогенеза БМ и ответа, генерируемого против инфекции и / или опухолей.Эти типы исследований также могут оказать гораздо более широкое влияние, определяя стратегии вакцинации против или иного контроля вирусных лимфом в медицине и ветеринарии.

    Дополнительная информация

    Рисунок S1.

    Моноклональные последовательности CDR3 в клеточных линиях MDV. Выравнивание аминокислотной последовательности TCRβ CDR3 для каждой клеточной линии, полученной путем трансляции in silico нуклеотидных последовательностей TCRβ CDR3, полученных из 13-15 независимых клонированных плазмидных вставок.Для справки, верхняя последовательность (жирный шрифт) в каждом выравнивании представляет немодифицированную последовательность зародышевой линии с подходящим Jβ. B) Нуклеотидные последовательности TCRβ CDR3 из каждой клеточной линии. Верхняя последовательность в каждом выравнивании (жирный шрифт) в Vβ 1 и Vβ 2 представляет собой сконструированную последовательность зародышевой линии (Vβ-Dβ-Jβ-Cβ). Общее количество повторов для каждой последовательности в виде доли от всех последовательностей и идентичности Jβ указано справа от последовательности.

    https://doi.org/10.1371/journal.ppat.1001337.s001

    (1,63 МБ EPS)

    Рисунок S2.

    Комплекс TCRVβ 2 Профили длины CDR3 в опухолях и отсортированные CD4 + клетки птиц 2 и 3. TCRVβ 2 Распределение длины CDR3 в образцах, проанализированных на Рисунке 3 (для TCRVβ 1 ), несортированных (левый столбец) и CD4 + популяции клеток, происходящих из опухолей (средний столбец). Продукт не был получен из культивированных клеток. Образцы, полученные из печени и почек двух птиц линии P 32 dpi с RB-1B MDV.Хотя распределение спектральных пиков было отклонено от распределения, наблюдаемого в несортированных или CD4 + клетках селезенки неинфицированных птиц (X 2 , p <0,001), в трансформированных культивируемых клетках не было представлено сигнала TCRVβ 2 .

    https://doi.org/10.1371/journal.ppat.1001337.s002

    (0,88 МБ EPS)

    Рисунок S3.

    Репертуар олигоклональных CDR3-последовательностей TCRVβ 2 в опухолях и CD4 + клетках птиц 2 и 3. Аминокислотные последовательности CDR3, полученные путем трансляции in silico TCRVβ 2 связанных нуклеотидных последовательностей CDR3.Образцы, полученные из печени и почек двух птиц линии P 32 dpi с RB-1B MDV, представляют собой несортированные опухоли (левый столбец) и популяции CD4 + клеток, полученных из опухолей (средний столбец), и клеточные линии, полученные из трех опухолей (правый столбец). Каждая последовательность происходит из клонированного продукта RTPCR, выбранного из отдельных трансформированных колоний E. coli . Выравнивания производят с областями TCRVβ 2, и Jβ, где возможные остатки последовательности Dβ также используются для выравнивания. Для простоты верхняя последовательность (жирная) получена в результате трансляции геномной конформации Vβ 2 , Dβ и Jβ 3 .Трансляция геномных последовательностей сегментов Jβ выглядит следующим образом: Jβ 1 , SNMIFGDGTKLTVI; Jβ 2 , NVRLIFGTGTKLTVL; Jβ 3 , NTPLNFGQGTRLTVL; Jβ 4 , YVNIQYFGEGTKVTVL: данные указывают на олигоклональный репертуар и идентифицируют некоторые TCRVβ 2 CDR3, связанные с CD4 + Т-клетками, и другие, не представленные в CD4 + клетках.

    https://doi.org/10.1371/journal.ppat.1001337.s003

    (1,98 МБ EPS)

    Рисунок S4.

    Доминантные CDR3-длины обнаруживаются в опухолях еще семи птиц.Распределение длин CDR3 TCR Vβ 1 (A) и Vβ 2 (B) на основе спектрального типа в опухолях печени, почек, яичников, мышц у семи птиц (B4-10). Включены лимфоциты селезенки и периферической крови, полученные при вскрытии. Искаженное распределение очевидно во всех участках опухоли по сравнению с профилями Vβ 1 и Vβ 2 от неинфицированных птиц (X 2 , p <0,001). Некоторые пики являются общими для разных опухолей в пределах одного хозяина, некоторые из них также наблюдаются в селезенке и PBL.Ли, печень; Kd, почка; Ov, яичник; Musl, мышца; Spl, селезенка; PBL, лимфоциты периферической крови.

    https://doi.org/10.1371/journal.ppat.1001337.s004

    (2,18 МБ EPS)

    Рисунок S5.

    Спектральные профили TCRVβ из восьми участков опухоли у четырех птиц. TCRVβ 1 (левая панель) и TCRVβ 2 (правая панель) Распределение длин CDR3 в несортированных и CD4 + популяциях клеток, полученных из опухолей и селезенки (Birds11–14). Образцы этих птиц были использованы для анализа репертуаров CD8 + TCR (рис. 7).Данные подтверждают присутствие доминантных клонов в CD4 + Т-клетках, полученных из участков опухоли (по сравнению с профилями, полученными от неинфицированных птиц), и что некоторые доминантные пики были общими для участков опухоли (в пределах одного человека), в то время как другие были сайт-специфичными. Распределение спектральных типов образцов сравнивали с эталонными профилями TCRVβ 1 или TCRVβ 2 из клеток селезенки CD8β +, полученных от неинфицированных птиц с помощью анализа X 2 ; статистическая значимость указана для каждой панели.NS = не значимо (при p> 0,05). Ли, печень; Kd, почка; Ov, яичник; Spl, селезенка.

    https://doi.org/10.1371/journal.ppat.1001337.s005

    (2,37 МБ EPS)

    Рисунок S6.

    TCRVβ 1 Идентичность CDR3-последовательности из образцов опухоли и селезенки птицы 11. Аминокислотные последовательности CDR3, полученные путем in silico трансляции нуклеотидных последовательностей TCRβ CDR3, несортированные опухоли (левый столбец) и популяции CD4 + клеток (правый столбец) ) происходит из опухолей и селезенки.Каждая последовательность происходит из клонированного продукта RTPCR, выбранного из отдельных трансформированных колоний E. coli . Выравнивания производят с областями TCRVβ и Jβ, где возможные остатки последовательности Dβ также используются для выравнивания. Для простоты верхняя последовательность (жирная) получена в результате трансляции геномной конформации Vβ, Dβ и Jβ 3 . Трансляция геномных последовательностей сегментов Jβ выглядит следующим образом: Jβ 1 , SNMIFGDGTKLTVI; Jβ 2 , NVRLIFGTGTKLTVL; Jβ 3 , NTPLNFGQGTRLTVL; Jβ 4 , YVNIQYFGEGTKVTVL.: Данные подтверждают, что доминантные клоны в опухолях MDV лежат в клетках CD4 + и что у одной птицы некоторые доминантные клоны являются общими более чем с одним сайтом, в то время как другие являются сайт-специфичными. Образцы птицы 11 также использовали для анализа репертуаров CD8 + TCR (фигура 7).

    https://doi.org/10.1371/journal.ppat.1001337.s006

    (1,74 МБ EPS)

    Рисунок S7.

    TCRVβ 2 Идентичность CDR3-последовательностей из образцов опухоли и селезенки птицы 11. Аминокислотные последовательности CDR3, полученные с помощью in silico трансляции нуклеотидных последовательностей TCRβ CDR3, несортированные опухоли (левый столбец) и популяции CD4 + клеток (правый столбец) ) происходит из опухолей и селезенки.Каждая последовательность происходит из клонированного продукта RTPCR, выбранного из отдельных трансформированных колоний E. coli . Выравнивания производят с областями TCRVβ и Jβ, где возможные остатки последовательности Dβ также используются для выравнивания. Для простоты верхняя последовательность (жирная) получена в результате трансляции геномной конформации Vβ, Dβ и Jβ 3 . Трансляция геномных последовательностей сегментов Jβ выглядит следующим образом: Jβ 1 , SNMIFGDGTKLTVI; Jβ 2 , NVRLIFGTGTKLTVL; Jβ 3 , NTPLNFGQGTRLTVL; Jβ 4 , YVNIQYFGEGTKVTVL.: Данные подтверждают, что доминантные клоны в опухолях MDV лежат в клетках CD4 + и что у одной птицы некоторые доминантные клоны являются общими более чем с одним сайтом, в то время как другие являются сайт-специфичными. Образцы птицы 11 также использовали для анализа репертуаров CD8 + TCR (фигура 7).

    https://doi.org/10.1371/journal.ppat.1001337.s007

    (1,64 МБ EPS)

    Рисунок S8.

    TCRVβ 1 Идентичность CDR3-последовательности из образцов опухоли и селезенки птицы 12. Аминокислотные последовательности CDR3, полученные путем in silico трансляции нуклеотидных последовательностей TCRβ CDR3, несортированные опухоли (левый столбец) и популяции CD4 + клеток (правый столбец) ) происходит из опухолей и селезенки.Каждая последовательность происходит из клонированного продукта RTPCR, выбранного из отдельных трансформированных колоний E. coli . Выравнивания производят с областями TCRVβ и Jβ, где возможные остатки последовательности Dβ также используются для выравнивания. Для простоты верхняя последовательность (жирная) получена в результате трансляции геномной конформации Vβ, Dβ и Jβ 3 . Трансляция геномных последовательностей сегментов Jβ выглядит следующим образом: Jβ 1 , SNMIFGDGTKLTVI; Jβ 2 , NVRLIFGTGTKLTVL; Jβ 3 , NTPLNFGQGTRLTVL; Jβ 4 , YVNIQYFGEGTKVTVL.: Данные подтверждают, что доминантные клоны в опухолях MDV лежат в клетках CD4 + и что у одной птицы некоторые доминантные клоны являются общими более чем с одним сайтом, в то время как другие являются сайт-специфичными. Образцы птицы 12 также использовали для анализа репертуаров CD8 + TCR (фиг. 7).

    https://doi.org/10.1371/journal.ppat.1001337.s008

    (1,64 МБ EPS)

    Рисунок S9.

    TCRVβ 2 Идентичность CDR3-последовательности из образцов опухоли и селезенки птицы 12. Аминокислотные последовательности CDR3, полученные путем in silico трансляции нуклеотидных последовательностей TCRβ CDR3, несортированные опухоли (левый столбец) и популяции CD4 + клеток (правый столбец) ) происходит из опухолей и селезенки.Каждая последовательность происходит из клонированного продукта RTPCR, выбранного из отдельных трансформированных колоний E. coli . Выравнивания производят с областями TCRVβ и Jβ, где возможные остатки последовательности Dβ также используются для выравнивания. Для простоты верхняя последовательность (жирная) получена в результате трансляции геномной конформации Vβ, Dβ и Jβ 3 . Трансляция геномных последовательностей сегментов Jβ выглядит следующим образом: Jβ 1 , SNMIFGDGTKLTVI; Jβ 2 , NVRLIFGTGTKLTVL; Jβ 3 , NTPLNFGQGTRLTVL; Jβ 4 , YVNIQYFGEGTKVTVL.: Данные подтверждают, что доминантные клоны в опухолях MDV лежат в клетках CD4 + и что у одной птицы некоторые доминантные клоны являются общими более чем с одним сайтом, в то время как другие являются сайт-специфичными. Образцы птицы 12 также использовали для анализа репертуаров CD8 + TCR (фиг. 7).

    https://doi.org/10.1371/journal.ppat.1001337.s009

    (1,70 МБ EPS)

    Благодарности

    Авторы хотят поблагодарить различных коллег за их вклад в обсуждение этих данных, включая профессора Джима Кауфмана (Кембриджский университет), доктора Джона Янга и доктора Колина Баттера (IAH), а также нынешних и бывших членов Группы вирусного онкогенеза и Enteric. Группа иммунологии в Институте здоровья животных.Мы также хотели бы поблагодарить доктора Оливера Пибуса (Оксфорд) за ценные советы со статистическим анализом и практическую помощь, оказанную мисс Хейзел Мюррей (Оксфорд) и доктором Мэрилин Перовал (IAH) в ходе этих экспериментов.

    Вклад авторов

    Задумал и спроектировал эксперименты: WNM VN ALS. Проведены эксперименты: WNM LPS SJB. Проанализированы данные: WNM LPS SJB VN ALS. Предоставленные реагенты / материалы / инструменты анализа: LPS SJB RKB VN ALS. Написал статью: WNM VN ALS.Разработана совместно с системой анализа репертуара птиц: WNM RKB ALS.

    Ссылки

    1. 1. Эпштейн М.А. (2001) Историческая справка. Philos Trans R Soc Lond B Biol Sci 356: 413–420.
    2. 2. Янг Л.С., Рикинсон А.Б. (2004) Вирус Эпштейна-Барра: 40 лет спустя. Нат Рев Рак 4: 757–768.
    3. 3. Ишицука К., Тамура К. (2008) Лечение Т-клеточного лейкоза / лимфомы взрослых: прошлое, настоящее и будущее. Eur J Haematol 80: 185–196.
    4. 4.Morrow CaFF (2004) Болезнь Марека: всемирная проблема. В: Дэвисон Т.Ф., Наир В., редакторы. Болезнь Марека - развивающаяся проблема. Лондон: Elsevier Academic Press. С. 49–61.
    5. 5. Берджесс С.К., Янг-младший, Баатен Б.Дж., Хант Л., Росс Л.Н. и др. (2004) Болезнь Марека - естественная модель лимфом, сверхэкспрессирующая антиген болезни Ходжкина (CD30). Proc Natl Acad Sci U S A 101: 13879–13884.
    6. 6. Щат К.А. (1987) Болезнь Марека: модель защиты от опухолей, индуцированных вирусом герпеса.Cancer Survv 6: 1–37.
    7. 7. Вайс Р.А. (1998) Онколог в долгу перед курицей. Патология птиц 27: S8 – S15.
    8. 8. Калнек Б.В. (1986) Болезнь Марека - модель герпесвирусной онкологии. Crit Rev Microbiol 12: 293–320.
    9. 9. Burgess SC, Basaran BH, Davison TF (2001) Устойчивость к лимфоме, вызванной вирусом герпеса, при болезни Марека является многофазной и зависит от генотипа хозяина. Vet Pathol 38: 129–142.
    10. 10. Burgess SC, Davison TF (2002) Идентификация неопластически трансформированных клеток в лимфомах, вызванных герпесвирусом болезни Марека: распознавание моноклональным антителом AV37.J Virol 76: 7276–7292.
    11. 11. Назериан К., Шарма Дж. М. (1975) Обнаружение поверхностных антигенов Т-клеток в линии лимфобластоидных клеток болезни Марека. J Natl Cancer Inst 54: 277–279.
    12. 12. Parcells MS, Dienglewicz RL, Anderson AS, Morgan RW (1999) Линии лимфобластоидных клеток, полученные из рекомбинантного вируса болезни Марека (MDV): регуляция маркерного гена в контексте генома MDV. J Virol 73: 1362–1373.
    13. 13. Schat KA, Chen CL, Calnek BW, Char D (1991) Трансформация субпопуляций Т-лимфоцитов вирусом герпеса болезни Марека.J Virol 65: 1408–1413.
    14. 14. Schat KA, Chen CL, Shek WR, Calnek BW (1982) Поверхностные антигены на линиях лимфобластоидных опухолевых клеток болезни Марека. J Natl Cancer Inst 69: 715–720.
    15. 15. Brown AC, Baigent SJ, Smith LP, Chattoo JP, Petherbridge LJ и др. (2006) Взаимодействие белка MEQ и белка, связывающего С-конец, имеет решающее значение для индукции лимфом вирусом болезни Марека. Proc Natl Acad Sci U S A 103: 1687–1692.
    16. 16. Росс Н., О'Салливан Дж., Ротвелл С., Смит Дж., Берджесс С.К. и др.(1997) Ген EcoRI-Q вируса болезни Марека (meq) и небольшая антисмысловая РНК к ICP4 в большом количестве экспрессируются в клетках CD4 + и клетках, несущих новый лимфоидный маркер, AV37, в лимфомах болезни Марека. J Gen Virol 78 (Pt 9): 2191–2198.
    17. 17. Xie Q, Anderson AS, Morgan RW (1996) Гены ICP4, pp38 и meq вируса болезни Марека (MDV) участвуют в поддержании трансформации лимфобластоидных клеток, трансформированных MDCC-MSB1. J Virol 70: 1125–1131.
    18. 18.Delecluse HJ, Hammerschmidt W (1993) Статус вируса болезни Марека в установленных клеточных линиях лимфомы: интеграция вируса герпеса является обычным явлением. J Virol 67: 82–92.
    19. 19. Delecluse HJ, Schuller S, Hammerschmidt W (1993) Вирус латентной болезни Марека может быть активирован из его хромосомно интегрированного состояния в клетках лимфомы, трансформированных герпесвирусом. EMBO J 12: 3277–3286.
    20. 20. Bublot MaSJ (2004) Вакцинация против болезни Марека. В: Дэвисон Т.Ф., Наир В., редакторы.Болезнь Марека - развивающаяся проблема. Лондон: Elsevier Academic Press. С. 168–182.
    21. 21. Дэвисон Ф., Наир В. (2005) Использование вакцин против болезни Марека: могут ли они привести вирус к увеличению вирулентности? Expert Rev Vaccines 4: 77–88.
    22. 22. Виттер Р.Л. (1998) Стратегии борьбы с болезнью Марека: перспектива на будущее. Poult Sci 77: 1197–1203.
    23. 23. Моримура Т., Охаши К., Сугимото С., Онума М. (1998) Патогенез болезни Марека (MD) и возможные механизмы иммунитета, индуцированного вакциной MD.J Vet Med Sci 60: 1–8.
    24. 24. Wu C, Gan J, Jin Q, Chen C, Liang P и др. (2009) Ревакцинация вакцинами против болезни Марека вызывает продуктивную инфекцию и повышенный иммунитет. Clin Vaccine Immunol 16: 184–193.
    25. 25. Bacon LD, Crittenden LB, Witter RL, Fadly A, Motta J (1983) B5 и B15, связанные с прогрессирующей болезнью Марека, саркомой Рауса и индуцированными вирусом птичьего лейкоза опухолями у инбредных цыплят 15I4. Poult Sci 62: 573–578.
    26. 26.Бэкон Л.Д., Виттер Р.Л. (1993) Влияние B-гаплотипа на относительную эффективность вакцин против болезни Марека различных серотипов. Птичий Дис 37: 53–59.
    27. 27. Bacon LD, Witter RL (1994) Влияние гаплотипа B на относительную эффективность вакцин против болезни Марека у коммерческих кур. Poult Sci 73: 481–487.
    28. 28. Bacon LD, Witter RL, Crittenden LB, Fadly A, Motta J (1981) Влияние B-гаплотипа на болезнь Марека, саркому Рауса и опухоли, индуцированные вирусом лимфолейкоза у кур.Poult Sci 60: 1132–1139.
    29. 29. Briles WE, Briles RW, Taffs RE, Stone HA (1983) Устойчивость к злокачественной лимфоме у кур сопоставляется с субрегионом главного комплекса гистосовместимости (B). Наука 219: 977–979.
    30. 30. Buscaglia C, Calnek BW (1988) Поддержание латентного периода герпесвируса болезни Марека in vitro с помощью фактора, обнаруженного в кондиционированной среде. J Gen Virol 69 (Pt 11): 2809–2818.
    31. 31. Kaiser P, Underwood G, Davison F (2003) Дифференциальные цитокиновые ответы после инфицирования вирусом болезни Марека цыплят, различающихся устойчивостью к болезни Марека.Дж. Вирол 77: 762–768.
    32. 32. Леви AM, Heller ED, Leitner G, Davidson I (1999) Эффект нативного куриного интерферона на репликацию MDV. Acta Virol 43: 121–127.
    33. 33. Volpini LM, Calnek BW, Sekellick MJ, Marcus PI (1995) Стадии латентного периода вируса болезни Марека, определяемые переменной чувствительностью к интерфероновой модуляции экспрессии вирусного антигена. Vet Microbiol 47: 99–109.
    34. 34. Xing Z, Schat KA (2000) Экспрессия генов цитокинов в инфицированных вирусом болезни Марека цыплятах и ​​культурах фибробластов куриных эмбрионов.Иммунология 100: 70–76.
    35. 35. Щат К.А. (1991) Важность клеточного иммунитета при болезни Марека и других вирусных опухолевых заболеваниях. Poult Sci 70: 1165–1175.
    36. 36. Schat KA, Markowski-Grimsrud CJ (2001) Иммунные ответы на вирусную инфекцию болезни Марека. Curr Top Microbiol Immunol 255: 91–120.
    37. 37. Markowski-Grimsrud CJ, Schat KA (2002) Ответ цитотоксических Т-лимфоцитов на гликопротеины, кодируемые герпесвирусом болезни Марека.Vet Immunol Immunopathol 90: 133–144.
    38. 38. Omar AR, Schat KA (1996), специфичные для вируса сингенной болезни Марека (MDV), клеточно-опосредованные иммунные ответы против немедленных ранних, поздних и уникальных белков MDV. Вирусология 222: 87–99.
    39. 39. Омар А.Р., Шат К.А. (1997) Характеристика герпесвирус-специфических цитотоксических Т-лимфоцитов болезни Марека у цыплят, инокулированных неонкогенным вакцинным штаммом MDV. Иммунология 90: 579–585.
    40. 40. Моримура Т., Чо КО, Кудо Й, Хирамото Ю., Охаши К. и др.(1999) Антивирусные и противоопухолевые эффекты, индуцированные ослабленным вирусом болезни Марека у цыплят с дефицитом CD4 или CD8. Arch Virol 144: 1809–1818.
    41. 41. Дэй Е.К., Кармайкл А.Дж., тен Берге И.Дж., Уоллер Е.К., Сиссонс Дж. Г. и др. (2007) Быстрое фокусирование репертуара CD8 + Т-клеток и отбор высокоаффинных клонов в память после первичного заражения персистирующим вирусом человека: цитомегаловирусом человека. J Immunol 179: 3203–3213.
    42. 42. Sacre K, Carcelain G, Cassoux N, Fillet AM, Costagliola D и др.(2005) Репертуар, разнообразие и дифференциация специфических CD8 Т-клеток связаны с иммунной защитой против цитомегаловирусной болезни человека. J Exp Med 201: 1999–2010.
    43. 43. Каллан М.Ф., Тан Л., Аннелс Н., Огг Г.С., Уилсон Дж. Д. и др. (1998) Прямая визуализация антиген-специфических CD8 + Т-клеток во время первичного иммунного ответа на вирус Эпштейна-Барра In vivo. J Exp Med 187: 1395–1402.
    44. 44. Hislop AD, Ressing ME, van Leeuwen D, Pudney VA, Horst D, et al.(2007) CD8 + T-клеточный белок уклонения от иммунитета, специфичный для вируса Эпштейна-Барра и его близких родственников у приматов Старого Света. J Exp Med 204: 1863–1873.
    45. 45. Мванги В.Н., Бил Р.К., Пауэрс К., Ву Х, Хамфри Т. и др. (2010) Региональные и глобальные изменения репертуаров TCRalphabeta T-клеток в кишечнике зависят от сложности кишечной микрофлоры. Dev Comp Immunol 34: 406–417.
    46. 46. Cooper MD, Chen CL, Bucy RP, Thompson CB (1991) Онтогенез птичьих Т-клеток.Adv Immunol 50: 87–117.
    47. 47. McCormack WT, Tjoelker LW, Stella G, Postema CE, Thompson CB (1991) Разнообразие бета-цепей куриного Т-клеточного рецептора: эволюционно консервативный D-бета-кодируемый поворот глицина в гипервариабельном домене CDR3. Proc Natl Acad Sci U S A 88: 7699–7703.
    48. 48. Сигета А., Сато М., Кавасима Т., Хориучи Х., Мацуда Х. и др. (2004) Геномная организация области D-J-C бета-цепи куриного Т-клеточного рецептора. J Vet Med Sci 66: 1509–1515.
    49. 49. Tjoelker LW, Carlson LM, Lee K, Lahti J, McCormack W.T. и др. (1990) Эволюционная консервация распознавания антигена: бета-цепь куриного Т-клеточного рецептора. Proc Natl Acad Sci U S A 87: 7856–7860.
    50. 50. Schat KA, Calnek BW, Fabricant J (1982) Характеристика двух высокоонкогенных штаммов вируса болезни Марека. Птичий Патол 11: 593–605.
    51. 51. Петербридж Л., Браун А.С., Бейджент С.Дж., Хоуз К., Сакко М.А. и др. (2004) Онкогенность вирулентного вируса болезни Марека, клонированного в виде бактериальных искусственных хромосом.J Virol 78: 13376–13380.
    52. 52. Петербридж Л., Хоус К., Бейджент С.Дж., Сакко М.А., Эванс С. и др. (2003) Компетентные к репликации бактериальные искусственные хромосомы вируса болезни Марека: новые инструменты для создания вакцин против вируса герпеса с молекулярным определением. J Virol 77: 8712–8718.
    53. 53. Chan MM, Chen CL, Ager LL, Cooper MD (1988) Идентификация птичьих гомологов антигенов CD4 и CD8 млекопитающих. J Immunol 140: 2133–2138.
    54. 54. Akiyama Y, Kato S (1974) Сканирующая электронная микроскопия линий лимфоидных клеток и лимфоцитов из тимуса, бурсы и крови цыплят.Бикен Дж 17: 193–197.
    55. 55. Назериан К., Виттер Р.Л. (1975) Свойства линии лимфобластоидных клеток курицы из опухоли болезни Марека. J Natl Cancer Inst 54: 453–458.
    56. 56. Payne LN, Howes K, Rennie M, Bumstead JM, Kidd AW (1981) Использование метода культивирования агара для создания линий лимфоидных клеток из лимфом болезни Марека. Int J Cancer 28: 757–766.
    57. 57. Назериан К., Стивенс Э.А., Шарма Дж. М., Ли Л. Ф., Гайлитис М. и др.(1977) Непродуцирующая линия Т-лимфобластоидных клеток из трансплантируемой опухоли при болезни Марека (JMV). Птичий Дис 21: 69–76.
    58. 58. Яо Ю., Чжао Ю., Смит Л.П., Лори С.Х., Сондерс Нью-Джерси и др. (2009) Дифференциальная экспрессия микроРНК в клеточных линиях Т-лимфомы, трансформированных вирусом болезни Марека. J Gen Virol 90: 1551–1559.
    59. 59. Яо Ю., Чжао Ю., Сюй Х., Смит Л.П., Лори С.Х. и др. (2008) Профиль микроРНК трансформированной вирусом болезни Марека линии Т-клеток MSB-1: преобладание микроРНК, кодируемых вирусом.J Virol 82: 4007-4015.
    60. 60. Dunon D, Schwager J, Dangy JP, Cooper MD, Imhof BA (1994) Миграция Т-клеток во время развития: самонаведение не связано с выбором репертуара TCR V beta 1. EMBO J 13: 808–815.
    61. 61. Agresti A, Coull B (1998) Приблизительное лучше, чем «точное» для интервальной оценки биномиальных пропорций. Am Stat 52: 119–126.
    62. 62. Назериан К. (1987) Обновленный список птичьих клеточных линий и трансплантируемых опухолей.Птичий Патол 16: 527–544.
    63. 63. Парвизи П., Рид Л. Р., Абдул-Карим М. Ф., Сарсон А. Дж., Ласти С. и др. (2009) Экспрессия гена цитокинов в подмножествах CD4 + и CD8 + Т-клеток селезенки генетически устойчивых и восприимчивых цыплят, инфицированных вирусом болезни Марека. Vet Immunol Immunopathol 132: 209–217.
    64. 64. Каллан М.Ф., Аннелс Н., Стивен Н., Тан Л., Уилсон Дж. И др. (1998) Селекция Т-клеток в процессе эволюции Т-клеточной памяти CD8 + in vivo. Eur J Immunol 28: 4382–4390.
    65. 65. Hislop AD, Taylor GS, Sauce D, Rickinson AB (2007) Клеточные реакции на вирусную инфекцию у людей: уроки вируса Эпштейна-Барра. Анну Рев Иммунол 25: 587–617.
    66. 66. Collette A, Cazenave PA, Pied S, Six A (2003) Новые методы и программные инструменты для высокопроизводительного спектрального типирования CDR3. Применение к модификации репертуара Т-лимфоцитов во время экспериментальной малярии. J Immunol Methods 278: 105–116.
    67. 67. Kedzierska K, La Gruta NL, Stambas J, Turner SJ, Doherty PC (2008) Отслеживание фенотипически и функционально различных подмножеств Т-клеток с помощью разнообразия репертуара Т-клеток.Мол Иммунол 45: 607–618.
    68. 68. Лонг С.А., Халили Дж., Эш Дж., Беренсон Р., Ферран С. и др. (2006) Стандартизованный анализ для количественной оценки разнообразия Т-клеточных рецепторов Vbeta CDR3. J Immunol Methods 317: 100–113.
    69. 69. Ohshima K, Suzumiya J, Kato A, Tashiro K, Kikuchi M (1997) Клональные HTLV-I-инфицированные CD4 + Т-лимфоциты и неклональные не-HTLV-I-инфицированные гигантские клетки в зарождающемся ATLL с гистологическими особенностями, подобными Ходжкинскому. Int J Cancer 72: 592–598.
    70. 70. Окаяма А., Стювер С., Мацуока М., Ишизаки Дж., Танака Г. и др. (2004) Роль провирусной ДНК HTLV-1 и клональность в развитии Т-клеточного лейкоза / лимфомы взрослых у бессимптомных носителей. Int J Cancer 110: 621–625.
    71. 71. Parcells MS, Burgess SC (2008) Иммунологические аспекты прогрессирования лимфомы, вызванного вирусом болезни Марека (MDV). Избранные аспекты развития рака: метастазы, апоптоз и иммунный ответ 169–191.
    72. 72.Parvizi P, Read L, Abdul-Careem MF, Lusty C, Sharif S (2009) Экспрессия гена цитокинов в подмножествах CD4 (+) и CD8 (+) Т-клеток селезенки цыплят, инфицированных вирусом болезни Марека. Вирусный иммунол 22: 31–38.
    73. 73. Абдул-Карим М.Ф., Хантер Д.Б., Ламбурн М.Д., Рид Л.Р., Парвизи П. и др. (2008) Экспрессия генов цитокинов после иммунизации цыплят до и после вылупления вирусом герпеса индеек. Vaccine 26: 2369–2377.
    74. 74. Абдул-Карим М.Ф., Хантер Д.Б., Шанмуганатан С., Хагиги Х.Р., Рид Л. и др.(2008) Клеточные и цитокиновые ответы в перьях цыплят, вакцинированных против болезни Марека. Vet Immunol Immunopathol 126: 362–366.
    75. 75. Абдул-Карим М.Ф., Хантер Б.Д., Сарсон А.Дж., Парвизи П., Хагиги Х.Р. и др. (2008) Ответы хозяина индуцируются в перьях цыплят, инфицированных вирусом болезни Марека. Вирусология 370: 323–332.
    76. 76. Каттан Т., Макнамара А., Роуэн А.Г., Нос Х., Мосли А.Дж. и др. (2009) Авидность и литическая эффективность ответа CTL на HTLV-1.J Immunol 182: 5723–5729.
    77. 77. Мосс П., Хан Н. (2004) CD8 (+) Т-клеточный иммунитет к цитомегаловирусу. Hum Immunol 65: 456–464.
    78. 78. Beverley PC (2004) Кинетика и клональность иммунологической памяти человека. Семин Иммунол 16: 315–321.
    79. 79. van Stipdonk MJ, Lemmens EE, Schoenberger SP (2001) Наивным CTL требуется один короткий период антигенной стимуляции для клональной экспансии и дифференцировки. Nat Immunol 2: 423–429.
    80. 80. Кауфман Дж., Милн С., Гобель Т.В., Уокер Б.А., Джейкоб Дж. П. и др. (1999) Локус курицы B представляет собой минимально важный главный комплекс гистосовместимости. Nature 401: 923–925.
    81. 81. Вентури В., Прайс Д.А., Дуек Д.К., Давенпорт депутат (2008) Молекулярная основа общественных Т-клеточных ответов? Nat Rev Immunol 8: 231–238.

    Моноклональные антитела против MDV (DMABT-51435MM) - Creative Diagnostics

    Авторы: Gimeno, I.М .; Щат, К.А.

    Здоровая иммунная система - краеугольный камень птицеводства. Любой фактор, снижающий иммунный ответ, повлияет на производственные параметры и увеличит стоимость. Существует множество инфекционных и неинфекционных факторов, вызывающих иммуносупрессию (ИИ) у кур. В данной статье рассматриваются три вирусных заболевания, которые чаще всего вызывают ИИ или субклинический ИИ у кур: вирус болезни Марека (MDV), вирус инфекционной анемии цыплят (CIAV) и вирус инфекционной бурсальной болезни (IBDV), а также взаимодействия между ними.MDV-индуцированный IS (MDV-IS) влияет как на гуморальный, так и на клеточный иммунные ответы. Это очень сложно, плохо понимается и во многих случаях недооценивается. Вакцинация защищает от некоторых, но не от всех аспектов MDV-IS. CIAV вызывает апоптоз гемоцитобластов, что приводит к анемии, кровотечениям и повышенной восприимчивости к бактериальным инфекциям. Он также вызывает апоптоз тимоцитов и деление Т-лимфоцитов, влияя на функции Т-хелперов, которые необходимы для выработки антител и функций цитотоксических Т-лимфоцитов (CTL).Контроль CIAV основан на вакцинации заводчиков и материнских антител (MAb). Однако субклинический ИИ может возникать после уменьшения количества МА. Инфекция IBDV влияет на врожденные иммунные ответы во время репликации вируса и гуморальные иммунные ответы как следствие разрушения популяций B-клеток. Для борьбы с IBDV используются вакцины с различными уровнями ослабления. При разработке планов вакцинации необходимо учитывать взаимодействие с МАт и остаточную вирулентность вакцин. Взаимодействие между IBDV, CIAV и MDV имеет решающее значение, хотя во многих случаях недооценивается.Надлежащий контроль IBDV является обязательным условием для правильного гуморального иммунного ответа, необходимого для контроля CIAV. В равной степени, длительный контроль MDV невозможен, если цыплята коинфицированы CIAV, поскольку CIAV ставит под угрозу функции CTL, критически важные для контроля MDV.

    MDV Сумка для установки деталей (опция) для спа-салонов и гидромассажных ванн с генераторами озона

    Смесительный бак для дегазации (MDV) - это дополнительный установочный комплект для больших гидромассажных ванн и бассейнов, оборудованных генератором озона. Его основная задача - удалить отходящие газы озона с поверхности спа.Лишь несколько производителей спа устанавливают их на большие бассейны * (например, Thermo Spas). MDV вряд ли будет установлен после того, как потребитель принесет домой свою гидромассажную ванну.

    Но, если вы сумасшедший ученый, которому не терпится установить сосуд для смешивания дегазации MDV компании DEL на свою гидромассажную ванну, дерзайте!

    MDV безопасно удаляет неиспользованный озон, чтобы он не попал в гидромассажную ванну. MDV удаляет пузыри, что означает, что поверхность гидромассажной ванны не нарушается. Устраняя отходящий газ озона, вы также продлеваете срок службы подушек и покрывала.

    MDV для курортов включает:

    (Если у вас есть ThermoSpas, возможно, у вас уже установлен MDV)

    Генератор озона в спа-салоне, чаще всего устанавливаемый с гидромассажной ванной MDV, - это MCD-250 для больших спа и гидромассажных ванн объемом до 3000 галлонов. Второе место занял озонатор HO (High Output), который имеет такую ​​же высокую производительность, что и MCD-250, но без светового индикатора или возможности обновления (проверьте цены ... свисток, свисток!).

    РЕСУРСНЫЙ ЦЕНТР | Загрузите следующие материалы:
    MDV для СПА Руководство по установке

    DEL Ozone. Заявление об отказе от ответственности за использование сосуда для дегазации MDV для спа-салонов:
    "Эта модель MDV разработана для установки вместо инжектора в наземных [переносных] спа-центрах с системой рециркуляции от 3 до 8 галлонов в минуту. и при давлении ниже 10 фунтов на квадратный дюйм.Это устройство должно быть подключено ниже уровня воды для правильной работы. Обратите внимание, что во всех случаях, когда нагнетание озона происходит ниже уровня воды, в линиях газового озона необходимы обратные клапаны. DEL рекомендует периодически заменять обратные клапаны, чтобы защитить ваши вложения в озонатор.

    Для спа-салонов, в которых используется двухскоростной насос, а не рециркуляционная система, или для рециркуляционных систем, расход которых превышает 8 галлонов в минуту, подключите MDV в конфигурации с боковым потоком, как показано на Рисунке 2 [см.Поскольку спа-салоны и водопроводные системы могут сильно различаться, DEL не может рекомендовать конкретное давление обратного клапана, которое будет работать во всех системах. Чтобы найти оптимальное решение для данной спа-системы, могут потребоваться эксперименты.

    Для водопроводных систем над поверхностью воды требуется другая модель MDV (MDV-10) ».

    .

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *