Содержание

Деление клетки амебы. Кишечная амеба у человека: строение цист, жизненный цикл

Амеба-протей — это одноклеточное животное, сочетающий в себе функции клетки и самостоятельного организма. Внешне обыкновенная амеба напоминает маленький студенистый комочек размером всего 0,5 мм, постоянно меняющий свою форму из за того, что амеба постоянно образует выросты — так называемые ложноножки, и как бы перетекает с места на место.

За такую изменчивость формы тела амебе обыкновенной и дали имя древнегреческого бога Протея, который умел изменять свой облик.

Строение амебы

Организм амебы состоит из одной клетки, и содержит цитоплазму, окруженную цитоплазматической мембраной. В цитоплазме находится ядро и вакуоли — сократительная вакуоль, выполняющая функции органа выделения, и пищеварительная вакуоль, служащая для переваривания пищи. Наружный слой цитоплазмы амебы более плотный и прозрачный, внутренний — более текучий и зернистый.

Амеба протей живет на дне небольших пресных водоемов — в прудах, лужах, канавах с водой.

Питание амебы

Питается амеба обыкновенная другими одноклеточными животными и водорослями, бактериями, микроскопическими остатками умерших животных и растений. Перетекая по дну, амеба наталкивается на добычу, и обволакивает ее со всех сторон с помощью ложноножек. При этом вокруг добычи образуется пищеварительная вакуоль, в которую из цитоплазмы начинают поступать пищеварительные ферменты, благодаря которым пища переваривается и затем всасывается в цитоплазму. Пищеварительная вакуоль перемещается к поверхности клетки в любом месте, и сливается с клеточной оболочкой, после чего открывается наружу, и непереваренные остатки пищи выбрасываются во внешнюю среду. Переваривание пищи в одной пищеварительной вакуоли занимает у амебы протея от 12 часов до 5 дней.

Выделение

В процессе жизнедеятельности любого организма, в том числе и у амебы, образуются вредные вещества, которые должны выводиться наружу. Для этого у амебы обыкновенной имеется сократительная вакуоль, в которую из цитоплазмы постоянно поступают растворенные вредные продукты жизнедеятельности. После того, как сократительная вакуоль наполнится, она перемещается к поверхности клетки и выталкивает содержимое наружу. Этот процесс повторяется постоянно — ведь сократительная вакуоль наполняется за несколько минут. Вместе с вредными веществами в процессе выделения удаляется также избыток воды. У простейших, живущих в пресной воде, концентрация солей в цитоплазме выше, чем во внешней среде, и вода постоянно поступает в клетку. Если лишнюю воду не удалять, клетка просто лопнет. У простейших же, живущих в соленой, морской воде сократительной вакуоли нет, у них вредные вещества удаляются через наружную мембрану.

Дыхание

Амеба дышит растворенным в воде кислородом. Как это происходит и для чего необходимо дыхание? Для того, чтобы существовать, любому живому организму нужна энергия. Если растения получают ее в процессе фотосинтеза, используя энергию солнечного света, то животные получают энергию в результате химических реакций окисления органических веществ, поступивших с пищей. Главным участником этих реакций является кислород. У простейших кислород поступает в цитоплазму через всю поверхность тела и участвует в реакциях окисления, при этом и выделяется необходимая для жизнедеятельности энергия. Кроме энергии, образуется углекислый газ, вода и некоторые другие химические соединения, которые затем выделяются из организма.

Размножение амебы

Амебы размножаются бесполым путем, с помощью деления клетки надвое. При этом сначала делится ядро, затем внутри амебы появляется перетяжка, которая делит амебу на две части, в каждой из которых находится по ядру. Затем по этой перетяжке части амебы разделяются друг от друга. Если условия благоприятные, то амеба делится примерно раз в сутки.

В неблагоприятных условиях, например, при пересыхании водоема, похолодании, изменении химического состава воды, а также осенью амеба превращается в цисту. Тело амебы при этом становится округлым, ложноножки исчезают, и ее поверхность покрывается очень плотной оболочкой, защищающей амебу от высыхания и других неблагоприятных условий. Цисты амебы легко переносятся ветром, и таким образом происходит заселение амебами других водоемов.

Когда условия внешней среды становятся благоприятными, амеба выходит из цисты и начинает вести обычный, активный образ жизни, питаться и размножаться.

Раздражимость

Раздражимость – это свойство всех животных реагировать на различные воздействия (сигналы) внешней среды. У амебы раздражимость проявляется способностью реагировать на свет – амеба уползает от яркого света, а также на механическое раздражение и изменение концентрации соли: амеба уползает в сторону, противоположную от механического раздражителя или от помещенного рядом с ней кристаллика соли.

Один из представителей одноклеточных животных (простейших), имеющих возможность самостоятельно передвигаться, используя так называемые «ложноножки» называется – Амеба обыкновенная или протей. Относится к типу корненожек из-за своего непостоянного вида, образующихся, изменяющихся и исчезающих ложноножек.

Она имеет форму маленького, еле различимого невооруженным глазом студенистого комочка, не имеющего цвета, размером около 0,5 мм, главная характеристика которого изменчивость формы, отсюда и название – «амеба», значит «изменчивая».

Детально рассмотреть строение клетки обыкновенной амебы без микроскопа невозможно.

Любой водоем с пресной стоячей водой – идеальная среда обитания для амебы, особенно предпочитает пруды с большим содержанием гниющих растений и болота, в которых обитают в большом количестве бактерии.

При этом она сможет выжить во влаге почвы, в капле росы, в воде внутри человека, и даже в обычный гниющий лист дерева может приметить амёба, амёбы, другими словами напрямую зависят от воды.

Наличие большого количества микроорганизмов и одноклеточных водорослей, явный признак присутствия протея в воде, так как она ими питается.

Когда наступают отрицательные условия для существования (наступление осени, пересыхание водоема), простейшее перестает питаться. Приобретая форму шарика, на теле одноклеточного появляется специальная оболочка – циста. Внутри этой пленки организм может находиться продолжительное время.

В состоянии цисты клетка пережидает засуху или холода (при этом простейшее не перемерзает и не засыхает), пока условия окружения не изменятся или циста не будет перенесена ветром в более благоприятное место, жизнь клетки амебы останавливается.

Так защищается от неблагоприятных условий амеба обыкновенная, когда среда обитания становится пригодной для жизни, протей выходит из оболочки и продолжает вести обычный образ жизни.

Существует способность к регенерации, когда тело повреждено, она может достроить разрушенное место, главное условие для этого процесса – целостность ядра.

Строение и обмен веществ простейшего


Чтобы рассмотреть внутреннее строение организма одноклеточного, необходим микроскоп. Он позволит увидеть, что строение тела амебы, представляет собой целый организм, который в состоянии самостоятельно выполнить все функции необходимые для выживания.

Ее тело покрыто тонкой пленкой, которая называется , и содержащая полужидкую цитоплазму. Внутренний слой цитоплазмы более жидкий и менее прозрачный, чем наружный. В ней находятся ядро и вакуоли

Для пищеварения и избавления не переваренных остатков используется пищеварительная вакуоль. начинает осуществляться с контакта с пищей, на поверхности тела клетки появляется «пищевая чашечка». Когда стенки «чашечки» смыкаются, туда поступает пищеварительный сок, так появляется пищеварительная вакуоль.

Образовавшиеся питательные вещества в результате пищеварения используются для построения тела протея.

Процесс пищеварения может занимать от 12 часов до 5 дней. Такой тип питания называется фагоцитоз. Чтобы дышать, простейшее поглощает воду всей поверхностью тела, из которой потом выделяет кислород.

Для выполнения функции выделения излишков воды, а также регулирования давления внутри тела, у амебы имеется сократительная вакуоль, через нее также иногда может происходить выделение продуктов жизнедеятельности. Так происходит дыхание амебы, процесс называется – пиноцитоз.

Передвижение и реакция на раздражители


Для передвижения амеба обыкновенная использует ложноножку, другое их название – псевдоподия или корненожка (из-за сходства с корнями растений). Они могут образовываться в любом месте на поверхности тела. Когда цитоплазма переливается к краю клетки, на поверхности протея появляется выпуклость, образуется ложная ножка.

В нескольких местах ножка прикрепляется к поверхности, в нее постепенно перетекает оставшаяся цитоплазма.

Таким образом, происходит передвижение, скорость которого примерно 0,2 мм в минуту. Клетка может образовать несколько псевдоподий. Организм реагирует на различные раздражители, т.е. обладает способностью чувствовать.

Размножение


Питаясь, клетка растет, увеличивается, наступает процесс, ради которого живут все существа – размножение.

Размножение амебы обыкновенной, процесс самый простой из известных науке, происходит бесполым путем, и подразумевает собой деление на части. Размножение начинается со стадии, когда ядро амебы начинает вытягиваться и сужаться посередине пока не разделится на две части. В это время тело самой клетки так же разделяется. В каждой из этих частей остаётся по ядру.

В конце концов, цитоплазма между двумя частями клетки разрывается, и образующийся новый клеточный организм отделяется от материнского, в котором остается сократительная вакуоль. Стадия деления обусловлена еще тем, что протей перестает питаться, останавливается пищеварение, тело приобретает округлый вид.

Таким образом, размножается протей. В течение суток клетка может размножаться несколько раз.

Значение в природе


Являясь важным элементом любой экосистемы, амеба обыкновенная регулирует количество бактерий и микроорганизмов в среде ее обитания. Тем самым поддерживая чистоту водоемов.

Таким образом, являясь частью пищевой цепочки, ею питаются мелкие рыбки, рачки и насекомые для которых она является пищей.

Тело амёбы протей (рис. 16) покрыто плазматической мембраной . Всеми дей-ствиями амебы руководит ядро . Цитоплазма находится в постоянном движении. Если её микропотоки устремляются к одной точке поверхности амебы, там появляется выпя-чивание. Оно увеличивается в размерах, становится вы-ростом тела. Это ложноножка, которая прикрепляется к частицам ила. В нее постепенно перетекает все содержимое амебы. Так происходит передвижение амебы с места на место.

Амеба протей — всеядное животное. Ее пищу составляют бактерии , одноклеточные растения и живот-ные, а также разлагающиеся органические частицы . Пере-двигаясь, амеба наталкивается на пищу и обтекает ее со всех сторон и та оказывается в цитоплазме (рис. 16). Во-круг пищи формируется пищеварительная вакуоль, куда поступают пищеварительные секреты, переваривающие пи-щу . Такой способ захвата пищи называется клеточным заглатыванием.

Амеба может питаться и жидкой пищей, используя другой способ — клеточное питье. Происходит это так. Снаружи внутрь цитоплазмы впячивается тонкая трубочка, в которую засасывается жидкая пища. Вокруг нее обра-зуется пищеварительная вакуоль.

Рис. 16. Строение и питание амебы

Выделение

Как и у бодо, вакуоль с непереваренными остатками пищи перемещается к поверхности тела амебы и ее содер-жимое выбрасывается наружу. Выделение вредных веществ жизнедеятельности и из-бытка воды происходит при помощи сокра-тительной (пульсирующей) вакуоли.

Дыхание

Дыхание у амебы осуществляется так же, как у бодо (см. Бодо — животное жгутиконосец ).

Каждый вид простейших животных имеет свое строение, свою форму, в том числе и очень сложную и причудливую. Она образуется не случайно, и сохраняется очень долго: на дне океана в отложениях, образовавшихся десятки миллионов лет назад, находят точно такие же раковины фораминифер.

Такое возможно потому, что у каждого вида построение организма осуществляется по определенному плану, опре-деленной программе. Эта программа записана особым ко-дом на длинных молекулах, хранящихся в ядре клетки , точно так же, как программы для компьютера записывают на магнитном жестком диске. Перед размножением с программы списывается копия, и передается потомству. Эти программы можно называть генетически закрепленными, или врожденными. Материал с сайта

Ядро клетки содержит не только программы, как ее построить, но и как действовать. Они определяют действия животного — его поведение . Подобно тому, как у одних простейших программы построения формы тела приводят к простой форме, а у других к сложной, так и программы поведения могут быть и простыми, и сложными. Разно-образие животных по сложности программы поведения не меньше, чем разнообразие их форм.

Амеба тоже реагирует на многие сигналы, запуская свои программы поведения. Так, она распознает разные виды микроскопических организмов, служащих ей пищей; уходит от яркого света; определяет концентрацию веществ в среде обитания; уходит от постоянного механического раздражения.

Происхождение саркодовых

В пре-делах жгутиконосцев проходит зыбкая граница (отличи-тельная черта) между двумя царствами — растениями и животными. На первый взгляд кажется, что между жи-вотными жгутиконосцами и саркодовыми имеется резкое различие: первые передвигаются при помощи жгутиков, вторые — с использованием ложноножек. Но оказывается, что саркодовые, считавшиеся ранее древнейшими простей-шими, ныне рассматриваются как эволюционные потомки животных жгутиконосцев. Дело в том, что у многих сар-кодовых во время размножения появляются жгутики, как, например, у половых клеток радиолярий и фораминифер. Следовательно, жгутики когда-то были и у саркодовых. Более того, известны животные жгутиконосцы (например, жгутиковая амеба), принимающие форму амебы для за-хвата пищи при помощи ложноножек. Все это позволяет считать, что саркодовые произошли от древних жгутиконосцев и утратили жгутики при дальнейшей эво-люции.

На этой странице материал по темам:

  • Ложноножки амебы это

  • Систематика амебы протей

  • Сообщение на тему амёба протей

  • Амебы протея реферат

  • Общее строение амебы протей

Вопросы по этому материалу:

Амебы — это род одноклеточных организмов-эукариот (относятся к простейшим). Считаются животноподобными, так как питаются гетеротрофно.

Строение амеб обычно рассматривают на примере типичного представителя — амебы обыкновенной (амебы протея).

Амеба обыкновенная (далее амеба) обитает на дне пресноводных водоемов с загрязненной водой. Ее размер колеблется от 0,2 мм до 0,5 мм. По внешнему виду амеба похожа на бесформенный бесцветный комок, способный менять свою форму.

Клетка амебы не имеет жесткой оболочки. Она образует выпячивания и впячивания. Выпячивания (цитоплазматические выросты) называют ложноножками или псевдоподиями . Благодаря им амеба может медленно двигаться, как бы перетекая с места на место, а также захватывать пищу. Образование ложноножек и перемещение амебы происходит за счет движения цитоплазмы, которая постепенно перетекает в выпячивание.

Хотя амеба одноклеточный организм и не может быть речи об органах и их системах, ей свойственны почти все процессы жизнедеятельности, характерные для многоклеточных животных. Амеба питается, дышит, выделяет вещества, размножается.

Цитоплазма амебы не однородна. Выделяют более прозрачный и плотный наружный слой (эк т оплазма ) и более зернистый и жидкий внутренний слой цитоплазмы (эндоплазма ).

В цитоплазме амебы находятся различные органеллы, ядро, а также пищеварительная и сократительная вакуоли.

Питается амеба различными одноклеточными организмами и органическими остатками. Пища обхватывается ложноножками и оказывается внутри клетки, образуется пищеварительн ая вакуоль . В нее поступают различные ферменты, расщепляющие питательные вещества. Те, которые нужны амебе, потом поступают в цитоплазму. Ненужные остатки пищи остаются в вакуоли, которая подходит к поверхности клетки и из нее все выбрасывается.

«Органом» выделения у амебы является сократительная вакуоль . В нее поступают излишки воды, ненужные и вредные вещества из цитоплазмы. Заполненная сократительная вакуоль периодически подходит к цитоплазматической мембране амебы и выталкивает наружу свое содержимое.

Дышит амеба всей поверхностью тела. В нее из воды поступает кислород, из нее — углекислый газ. Процесс дыхания заключается в окислении кислородом органических веществ в митохондриях. В результате выделяется энергия, которая запасается в АТФ, а также образуются вода и углекислый газ. Энергия, запасенная в АТФ, далее расходуется на различные процессы жизнедеятельности.

Для амебы описан только бесполый способ размножения путем деления надвое. Делятся только крупные, т. е. выросшие, особи. Сначала делится ядро, после чего клетка амебы делится перетяжкой. Та дочерняя клетка, которая не получает сократительную вакуоль, образует ее впоследствии.

С наступлением холодов или засухи амеба образует цисту . Цисты имеет плотную оболочку, выполняющую защитную функцию. Они достаточно легкие и могут разноситься ветром на большие расстояния.

Амеба способна реагировать на свет (уползает от него), механическое раздражение, наличие в воде определенных веществ.

Амёба протей или обыкновенная амёба – лат. Amoeba proteus. Амёба протей или представляет собой огромный амебоидный организм, представитель класса лобозные амёбы, относится к типу простейшие . Встречается в пресных водах, аквариумах .

В капле воды, взятой из пруда, болота, канавы или аквариума, если ее рассматривать под микроскопом, открывается целый мир живых существ. Среди них имеются крошечные полупрозрачные беспозвоночные животные, непрестанно изменяющие форму своего тела.

Обыкновенная амеба, как и инфузория туфелька – самые простые по своему строению животные. Чтобы рассмотреть обыкновенную амёбу, необходимо поместить каплю воды с амебами под микроскоп. Все тело обыкновенной амебы состоит из крошечного студенистого комочка живого вещества – протоплазмы с ядром внутри. Из курса ботаники известно, что комочек протоплазмы с ядром – это клетка. Значит, обыкновенная амёба – одноклеточное беспозвоночное животное. Тело её состоит только из протоплазмы и ядра.

Наблюдая за амебой протей под микроскопом, мы замечаем, что через некоторое время форма ее тела изменяется. Амеба протей не имеет постоянной формы тела. Поэтому она и получила название «амёба», что в переводе с греческого языка означает «изменчивая».

Также под микроскопом, можно заметить, что она медленно переползает на затемненную часть стекла. Яркий солнечный свет быстро убивает обыкновенных амеб. Если внести в капельку воды кристаллик поваренной соли, амеба пере-стает двигаться, втягивает ложноножки и приобретает шарообразную форму. Таким образом, обыкновенные амебы уменьшают поверхность тела, на которую действует вредный для них раствор соли. Значит, обыкновенные амебы способны отвечать на внешние раздражения. Эта способность называется раздражимостью. Она связывает обыкновенную амебу с внешней средой и имеет защитное значение.

Обыкновенных амеб можно найти даже в канавах и лужах, образовавшихся совсем недавно. Когда водоем, в котором живут обыкновенные амебы и другие простейшие, начинает высыхать, они не погибают, а покрываются плотной оболочкой, превращаясь в цисту. В таком состоянии амебы и другие простейшие могут переносить как высокую температуру (до +50, +60°), так и сильное охлаждение (до – 273 градусов). Ветром цисты разносятся на значительные расстояния. Когда такая циста снова попадает в благоприятные условия, она начинает питаться и размножаться. Благодаря такому приспособлению, обыкновенные амёбы переживают неблагоприятные для них условия жизни и расселяются по всей планете. Передвижение амёбы происходит при помощи ложноножек.

Питается амёба бактериями, водорослями, микроскопическими грибами. С помощью ложноножек (из-за которых осуществляется перемещение амёбы), захватывает пищу.

Амёбе протей, также, как и всем животным, необходим кислород. Дыхание амёбы осуществляется за счёт усваивания кислорода из воды и выделением углекислого газа.

Размножаются обыкновенные амёбы делением. При этом ядро амебы удлиняется, а затем делится пополам.

Для чего амебе нужны ложноножки. Строение и жизнедеятельность амебы

Амёба протей или обыкновенная амёба – лат. Amoeba proteus. Амёба протей или представляет собой огромный амебоидный организм, представитель класса лобозные амёбы, относится к типу простейшие . Встречается в пресных водах, аквариумах .

В капле воды, взятой из пруда, болота, канавы или аквариума, если ее рассматривать под микроскопом, открывается целый мир живых существ. Среди них имеются крошечные полупрозрачные беспозвоночные животные, непрестанно изменяющие форму своего тела.

Обыкновенная амеба, как и инфузория туфелька – самые простые по своему строению животные. Чтобы рассмотреть обыкновенную амёбу, необходимо поместить каплю воды с амебами под микроскоп. Все тело обыкновенной амебы состоит из крошечного студенистого комочка живого вещества – протоплазмы с ядром внутри. Из курса ботаники известно, что комочек протоплазмы с ядром – это клетка. Значит, обыкновенная амёба – одноклеточное беспозвоночное животное. Тело её состоит только из протоплазмы и ядра.

Наблюдая за амебой протей под микроскопом, мы замечаем, что через некоторое время форма ее тела изменяется. Амеба протей не имеет постоянной формы тела. Поэтому она и получила название «амёба», что в переводе с греческого языка означает «изменчивая».

Также под микроскопом, можно заметить, что она медленно переползает на затемненную часть стекла. Яркий солнечный свет быстро убивает обыкновенных амеб. Если внести в капельку воды кристаллик поваренной соли, амеба пере-стает двигаться, втягивает ложноножки и приобретает шарообразную форму. Таким образом, обыкновенные амебы уменьшают поверхность тела, на которую действует вредный для них раствор соли. Значит, обыкновенные амебы способны отвечать на внешние раздражения. Эта способность называется раздражимостью. Она связывает обыкновенную амебу с внешней средой и имеет защитное значение.

Обыкновенных амеб можно найти даже в канавах и лужах, образовавшихся совсем недавно. Когда водоем, в котором живут обыкновенные амебы и другие простейшие, начинает высыхать, они не погибают, а покрываются плотной оболочкой, превращаясь в цисту. В таком состоянии амебы и другие простейшие могут переносить как высокую температуру (до +50, +60°), так и сильное охлаждение (до – 273 градусов). Ветром цисты разносятся на значительные расстояния. Когда такая циста снова попадает в благоприятные условия, она начинает питаться и размножаться. Благодаря такому приспособлению, обыкновенные амёбы переживают неблагоприятные для них условия жизни и расселяются по всей планете. Передвижение амёбы происходит при помощи ложноножек.

Питается амёба бактериями, водорослями, микроскопическими грибами. С помощью ложноножек (из-за которых осуществляется перемещение амёбы), захватывает пищу.

Амёбе протей, также, как и всем животным, необходим кислород. Дыхание амёбы осуществляется за счёт усваивания кислорода из воды и выделением углекислого газа.

Размножаются обыкновенные амёбы делением. При этом ядро амебы удлиняется, а затем делится пополам.

Тело амёбы протей (рис. 16) покрыто плазматической мембраной . Всеми дей-ствиями амебы руководит ядро . Цитоплазма находится в постоянном движении. Если её микропотоки устремляются к одной точке поверхности амебы, там появляется выпя-чивание. Оно увеличивается в размерах, становится вы-ростом тела. Это ложноножка, которая прикрепляется к частицам ила. В нее постепенно перетекает все содержимое амебы. Так происходит передвижение амебы с места на место.

Амеба протей — всеядное животное. Ее пищу составляют бактерии , одноклеточные растения и живот-ные, а также разлагающиеся органические частицы . Пере-двигаясь, амеба наталкивается на пищу и обтекает ее со всех сторон и та оказывается в цитоплазме (рис. 16). Во-круг пищи формируется пищеварительная вакуоль, куда поступают пищеварительные секреты, переваривающие пи-щу . Такой способ захвата пищи называется клеточным заглатыванием.

Амеба может питаться и жидкой пищей, используя другой способ — клеточное питье. Происходит это так. Снаружи внутрь цитоплазмы впячивается тонкая трубочка, в которую засасывается жидкая пища. Вокруг нее обра-зуется пищеварительная вакуоль.

Рис. 16. Строение и питание амебы

Выделение

Как и у бодо, вакуоль с непереваренными остатками пищи перемещается к поверхности тела амебы и ее содер-жимое выбрасывается наружу. Выделение вредных веществ жизнедеятельности и из-бытка воды происходит при помощи сокра-тительной (пульсирующей) вакуоли.

Дыхание

Дыхание у амебы осуществляется так же, как у бодо (см. Бодо — животное жгутиконосец ).

Каждый вид простейших животных имеет свое строение, свою форму, в том числе и очень сложную и причудливую. Она образуется не случайно, и сохраняется очень долго: на дне океана в отложениях, образовавшихся десятки миллионов лет назад, находят точно такие же раковины фораминифер.

Такое возможно потому, что у каждого вида построение организма осуществляется по определенному плану, опре-деленной программе. Эта программа записана особым ко-дом на длинных молекулах, хранящихся в ядре клетки , точно так же, как программы для компьютера записывают на магнитном жестком диске. Перед размножением с программы списывается копия, и передается потомству. Эти программы можно называть генетически закрепленными, или врожденными. Материал с сайта

Ядро клетки содержит не только программы, как ее построить, но и как действовать. Они определяют действия животного — его поведение . Подобно тому, как у одних простейших программы построения формы тела приводят к простой форме, а у других к сложной, так и программы поведения могут быть и простыми, и сложными. Разно-образие животных по сложности программы поведения не меньше, чем разнообразие их форм.

Амеба тоже реагирует на многие сигналы, запуская свои программы поведения. Так, она распознает разные виды микроскопических организмов, служащих ей пищей; уходит от яркого света; определяет концентрацию веществ в среде обитания; уходит от постоянного механического раздражения.

Происхождение саркодовых

В пре-делах жгутиконосцев проходит зыбкая граница (отличи-тельная черта) между двумя царствами — растениями и животными. На первый взгляд кажется, что между жи-вотными жгутиконосцами и саркодовыми имеется резкое различие: первые передвигаются при помощи жгутиков, вторые — с использованием ложноножек. Но оказывается, что саркодовые, считавшиеся ранее древнейшими простей-шими, ныне рассматриваются как эволюционные потомки животных жгутиконосцев. Дело в том, что у многих сар-кодовых во время размножения появляются жгутики, как, например, у половых клеток радиолярий и фораминифер. Следовательно, жгутики когда-то были и у саркодовых. Более того, известны животные жгутиконосцы (например, жгутиковая амеба), принимающие форму амебы для за-хвата пищи при помощи ложноножек. Все это позволяет считать, что саркодовые произошли от древних жгутиконосцев и утратили жгутики при дальнейшей эво-люции.

На этой странице материал по темам:

  • Ложноножки амебы это

  • Систематика амебы протей

  • Сообщение на тему амёба протей

  • Амебы протея реферат

  • Общее строение амебы протей

Вопросы по этому материалу:

Амёба обыкновенная (протей) – вид простейших животных из рода амёбы подкласса корненожки класса саркодовые типа саркомастигофоры. Это типичный представитель рода амёб, представляющий собой сравнительно крупный амёбоидный организм, отличительной особенностью которого является формирование множества ложноножек (10 и более у одной особи). Форма амёбы обыкновенной при движении за счет псевдоподий весьма изменчива. Так, ложноножки постоянно меняют вид, ветвятся, исчезают и снова образуются. Если амёба выпускает псевдоподии в определенном направлении, она может передвигаться со скоростью до 1,2 см в час. В состоянии покоя форма амёбы протея шаровидная либо эллипсовидная. В свободном плавании у поверхности водоёмов амёба приобретает звёздчатую форму. Таким образом, существуют флотирующие и локомоторные формы.

Средой обитания данного вида амёб являются пресные водоемы со стоячей водой, в частности, в болота, загнивающие пруды, а также аквариумы. Амёба протей встречается по всему земному шару.

Размеры этих организмов колеблются от 0,2 до 0,5 мм. Строение амёбы протея имеет характерные особенности. Внешней оболочкой тела амёбы обыкновенной является плазмалемма. Под ней находится цитоплазма с органеллами. Цитоплазма делится на две части – наружную (эктоплазму) и внутреннюю (эндоплазму). Основная функция прозрачной, относительно однородной эктоплазмы – это образование псевдоподий для улавливания пищи и передвижения. В плотной зернистой эндоплазме заключены все органеллы, там же происходит переваривание пищи.

Питание обыкновенной амёбы осуществляется путем фагоцитоза мельчайших простейших, в том числе инфузорий, бактерий, одноклеточных водорослей. Пища захватывается псевдоподиями – выростами цитоплазмы клетки амёбы. При соприкосновении плазмалеммы и пищевой частицы образуется вдавление, которое превращается в пузырек. Туда интенсивно начинают выделяться пищеварительные ферменты. Так происходит процесс формирования пищеварительной вакуоли, которая далее переходит в эндоплазму. Воду амёба получает путем пиноцитоза. При этом на поверхности клетки формируется впячивание наподобие трубочки, по которой в организм амёбы поступает жидкость, затем образуется вакуоль. При всасывании воды данная вакуоль исчезает. Выделение непереваренных пищевых остатков происходит в любом участке поверхности тела при слиянии вакуоли, перемещенной из эндоплазмы, с плазмалеммой.

В эндоплазме амёбы обыкновенной размещаются, кроме пищеварительных вакуолей, сократительные вакуоли, одно относительно крупное дискоидальное ядро и включения (жировые капли, полисахариды, кристаллы). Органоиды и гранулы в эндоплазме находятся в постоянном движении, подхватываемые и переносимые токами цитоплазмы. В новообразованной ложноножке цитоплазма смещается к ее краю, а в укорачивающейся, наоборот, — вглубь клетки.

Амёба протей реагирует на раздражение – на пищевые частицы, свет, отрицательно – на химические вещества (хлорид натрия).

Размножение амёбы обыкновенной бесполое делением клетки пополам. Перед началом процесса деления амёба прекращает двигаться. Вначале происходит деление ядра, затем цитоплазмы. Половой процесс отсутствует.

Амебы — это род одноклеточных организмов-эукариот (относятся к простейшим). Считаются животноподобными, так как питаются гетеротрофно.

Строение амеб обычно рассматривают на примере типичного представителя — амебы обыкновенной (амебы протея).

Амеба обыкновенная (далее амеба) обитает на дне пресноводных водоемов с загрязненной водой. Ее размер колеблется от 0,2 мм до 0,5 мм. По внешнему виду амеба похожа на бесформенный бесцветный комок, способный менять свою форму.

Клетка амебы не имеет жесткой оболочки. Она образует выпячивания и впячивания. Выпячивания (цитоплазматические выросты) называют ложноножками или псевдоподиями . Благодаря им амеба может медленно двигаться, как бы перетекая с места на место, а также захватывать пищу. Образование ложноножек и перемещение амебы происходит за счет движения цитоплазмы, которая постепенно перетекает в выпячивание.

Хотя амеба одноклеточный организм и не может быть речи об органах и их системах, ей свойственны почти все процессы жизнедеятельности, характерные для многоклеточных животных. Амеба питается, дышит, выделяет вещества, размножается.

Цитоплазма амебы не однородна. Выделяют более прозрачный и плотный наружный слой (эк т оплазма ) и более зернистый и жидкий внутренний слой цитоплазмы (эндоплазма ).

В цитоплазме амебы находятся различные органеллы, ядро, а также пищеварительная и сократительная вакуоли.

Питается амеба различными одноклеточными организмами и органическими остатками. Пища обхватывается ложноножками и оказывается внутри клетки, образуется пищеварительн ая вакуоль . В нее поступают различные ферменты, расщепляющие питательные вещества. Те, которые нужны амебе, потом поступают в цитоплазму. Ненужные остатки пищи остаются в вакуоли, которая подходит к поверхности клетки и из нее все выбрасывается.

«Органом» выделения у амебы является сократительная вакуоль . В нее поступают излишки воды, ненужные и вредные вещества из цитоплазмы. Заполненная сократительная вакуоль периодически подходит к цитоплазматической мембране амебы и выталкивает наружу свое содержимое.

Дышит амеба всей поверхностью тела. В нее из воды поступает кислород, из нее — углекислый газ. Процесс дыхания заключается в окислении кислородом органических веществ в митохондриях. В результате выделяется энергия, которая запасается в АТФ, а также образуются вода и углекислый газ. Энергия, запасенная в АТФ, далее расходуется на различные процессы жизнедеятельности.

Для амебы описан только бесполый способ размножения путем деления надвое. Делятся только крупные, т. е. выросшие, особи. Сначала делится ядро, после чего клетка амебы делится перетяжкой. Та дочерняя клетка, которая не получает сократительную вакуоль, образует ее впоследствии.

С наступлением холодов или засухи амеба образует цисту . Цисты имеет плотную оболочку, выполняющую защитную функцию. Они достаточно легкие и могут разноситься ветром на большие расстояния.

Амеба способна реагировать на свет (уползает от него), механическое раздражение, наличие в воде определенных веществ.

К данному классу относятся одноклеточные животные, которым свойственна непостоянная форма тела. Это связано с образованием ложноножек, служащих для передвижения и захвата пищи. Многие корненожки имеют внутренний или наружный скелет в виде раковин. После смерти эти скелеты оседают на дно водоемов и образуют ил, постепенно превращающийся в мел.

Типичный представитель этого класса — амеба обыкновенная (рис. 1).

Строение и размножение амебы

Амеба — одно из наиболее просто устроенных животных, лишено скелета. Обитает в иле на дне канав и прудов. Внешне тело амебы представляет собой сероватый студенистый комочек размером 200-700 мкм, не имеющий постоянной формы, который состоит из цитоплазмы и пузырьковидного ядра и не имеет раковины. В протоплазме выделяется наружный, более вязкий (эктоплазма) и внутренний зернистый, более жидкий (эндоплазма) слой.

На теле амебы постоянно образуются меняющие свою форму выросты — ложные ножки (псевдоподии). В один из таких выступов постепенно переливается цитоплазма, ложная ножка в нескольких точках прикрепляется к субстрату и происходит передвижение амебы. Передвигаясь, амеба наталкивается на одноклеточные водоросли, бактерии, мелкие одноклеточные, охватывает их ложноножками так, что они оказываются внутри тела, образуя пищеварительную вакуоль вокруг заглоченного кусочка в которой происходит внутриклеточное пищеварение. Непереваренные остатки выбрасываются наружу в любом участке тела. Способ захвата пищи с помощью ложных ножек называется фагоцитозом. Жидкость поступает в тело амебы по образующимся тонким трубковидным каналам, т.е. путем пиноцитоза. Конечные продукты жизнедеятельности (углекислый газ и другие вредные вещества и непереваренные остатки пищи) выделяются с водой через пульсирующую (сократительную) вакуоль, удаляющую излишки жидкости через каждые 1-5 мин.

Специального органоида дыхания у амебы нет. Необходимый для жизни кислород она поглощает всей поверхностью тела.

Амебы размножаются только бесполым путем (митозом). В неблагоприятных условиях (например, при высыхании водоема) амебы втягивают псевдоподии, покрываются прочной двойной оболочкой и образуют цисты (инцистируется).

При воздействии внешних раздражителей (свет, изменение химического состава среды) амеба отвечает двигательной реакцией (таксис), которая в зависимости от направления движения может быть положительной либо отрицательной.

Другие представители класса

Многие виды саркодовых обитают в морских и пресных водах. Некоторые саркодовые на поверхности тела имеют скелет в виде раковины (раковинные корненожки, фораминиферы). Раковинки таких саркодовых пронизаны порами, из которых выпячиваются псевдоподии. У раковинных корненожек наблюдается размножение множественным делением — шизогонией. Для морских корненожек (фораминиферы) характерно чередование бесполого и полового поколений.

Обладающие скелетом саркодовые относятся к числу древнейших обитателей Земли. Из их скелетов образовались мел и известняки. Для каждого геологического периода характерны свои фораминиферы и по ним часто определяют возраст геологических пластов. Скелеты определенных видов раковинных корненожек сопутствуют отложению нефти, что учитывается при геологоразведочных изысканиях.

Дизентерийная амеба (Entamoeba histolytica) — возбудитель амебной дизентерии (амебиаза). Открыта Ф. А. Лешем в 1875 г.

Локализация . Кишечник человека.
. Повсеместно, но чаще в странах с жарким климатом.

Морфологические особенности и жизненный цикл . В кишечнике человека в жизненном цикле встречаются следующие формы:

  • цисты — 1, 2, 5-10 (рис. 2).
  • мелкая вегетативная форма, обитающая в просвете кишок (forma minuta) — 3, 4;
  • крупной вегетативная форма, обитающая в просвете кишок (forma magna) — 13-14
  • тканевая, патогенная, крупная вегетативная форма (forma magna) — 12;

Характерной особенностью цист дизентерийной амебы является наличие в них 4 ядер (отличительный видовой признак), размер цист от 8 до 18 мкм.

В кишечник человека дизентерийная амеба попадает обычно в виде цист. Здесь оболочка проглоченной цисты растворяется и из нее выходит четырехядерная амеба, которая быстро делится на 4 одноядерные мелкие (7-15 мкм в диаметре) вегетативные формы (f. minuta). Это основная форма существования Е. histolytica.

Мелкая вегетативная форма обитает в просвете толстого кишечника, питается в основном бактериями, размножается и не вызывает заболевания. Если условия не благоприятствуют переходу в тканевую форму, то амебы, попадая в нижние отделы кишечника, инцистируются (превращаются в цисту) с образованием 4-х ядерной цисты и выводятся во внешнюю среду с фекалиями.

Если же условия способствуют переходу в тканевую форму (Е. histolytica forma magna), амеба увеличивается в размере в среднем до 23 мкм, достигая иногда 30 и даже 50 мкм, и приобретает способность выделять гиалуронидазу, протеолитические ферменты, растворяющие тканевые белки и проникать в стенки кишечника, где интенсивно размножается и вызывает поражение слизистой с образованием язв. При этом разрушаются стенки кровеносных сосудов и возникают кровотечения в полость кишечника.

При появлении амебных поражений кишечника мелкие вегетативные формы, находящиеся в просвете кишечника, начинают превращаться в крупную вегетативную форму. Последняя характеризуется крупными размерами (30-40 мкм) и строением ядра: хроматин ядра образует радиальные структуры, строго в центре располагается крупная глыбка хроматина — кариосома, forma magna начинает питаться эритроцитами, т. е. становится эритрофагом. Характерны тупые широкие псевдоподии и передвижение толчками.

Амебы, размножающиеся в тканях стенки кишечника, — тканевая форма, — попадая в просвет кишечника, по строению и размерам становятся сходными с крупной вегетативной формой, но не способны заглатывать эритроциты.

При лечении или нарастании защитной реакции организма крупная вегетативная форма (Е. histolytica forma magna) вновь превращается в мелкую (Е. histolytica forma minuta), которая начинает инцистироваться. В последующем или наступает выздоровление, или заболевание переходит в хроническую форму.

Условия, необходимые для превращения одних форм дизентерийной амебы в другие, изучены советским протистологом В. Гнездиловым. Оказалось, что различные неблагоприятные факторы — переохлаждение, перегревание, недоедание, переутомление и т.д.- способствуют переходу forma minuta в forma magna. Необходимым условием является также присутствие определенных видов кишечных бактерий. Иногда зараженный человек многие годы выделяет цисты при отсутствии признаков заболевания. Таких людей называют цистоносителями. Они представляют собой большую опасность, так как служат источником заражения окружающих. За сутки один цистоноситель выделяет до 600 млн. цист. Цистоносители подлежат выявлению и обязательному лечению.

Единственный источник заболевания амебиазом — человек. Выделяющиеся с фекалием цисты загрязняют почву и воду. Поскольку фекалии нередко используют как удобрение, цисты попадают в огород и сад, где загрязняют овощи и фрукты. Цисты устойчивы к воздействию внешней среды. В кишечник попадают с немытыми овощами и фруктами, через некипяченую воду, грязные руки. Механическими переносчиками служат мухи, тараканы, загрязняющие пищу.

Патогенное действие . При внедрении амебы в стенки кишечника развивается тяжелое заболевание, основными симптомами которого служат: кровоточащие язвы в кишечнике, частый и жидкий стул (до 10-20 раз в сутки) с примесью крови и слизи. Иногда по кровеносным сосудам дизентерийная амеба — эритрофаг может заноситься в печень и другие органы, вызывая там образование абсцессов (очаговые нагноения). При отсутствии лечения смертность достигает 40%.

Лабораторная диагностика . Микроскопирование: мазков фекалий. В остром периоде в мазке находятся крупные вегетативные формы, содержащие эритроциты; цисты обычно отсутствуют, так как f. magna не способна инцистироваться. При хронической форме или цистоносительстве в фекалиях обнаруживаются четырехядерные цисты.

Профилактика : личная — обмывание овощей и фруктов кипяченой водой, употребление для питья только кипяченой воды, мытье рук перед едой, после посещения туалета и т. д.; общественная — борьба с загрязнением почвы и воды фекалиями, уничтожение мух, санитарно-просветительная работа, обследование на цистоносительство лиц, работающих на предприятиях общественного питания, лечение больных.

К числу непатогенных амеб относятся кишечная и ротовая амебы.

Кишечная амеба (Entamoeba coli) .

Локализация . Верхний отдел толстой кишки, обитает только в просвете кишечника.

Географическое распространение . Обнаруживается примерно у 40-50% населения различных областей земного шара.

. Вегетативная форма имеет размеры 20-40 мкм, но иногда встречаются и более крупные формы. Резкая граница между экто- и эндоплазмой отсутствует. Обладает характерным способом передвижения — одновременно выпускает псевдоподии с разных сторон и как бы «топчется на месте». Ядро содержит крупные глыбки хроматина, ядрышко лежит эксцентрично, радиальная структура отсутствует. Не выделяет протеолитического фермента, в стенку кишечника не проникает, питается бактериями, грибками, остатками растительной и животной пищи. В эндоплазме содержится много вакуолей. Эритроциты не заглатывает, даже если они содержатся в кишечнике в большом количестве (у больных бактериальной дизентерией). В нижнем отделе пищеварительного тракта образует восьми- и двухядерные цисты.

Ротовая амеба (Entamoeba gingivalis) .

Локализация . Ротовая полость, зубной налет у здоровых людей и имеющих заболевания полости рта, кариозные полости зубов.

Географическое распространение . Повсеместно.

Морфофизиологическая характеристика . Вегетативная форма имеет размеры от 10 до 30 мкм, сильно вакуолизированную цитоплазму. Тип передвижения и строение ядра напоминают дизентерийную амебу. Эритроциты не заглатывает, питается бактериями, грибками. Кроме того, в вакуолях обнаруживают ядра лейкоцитов или так называемые слюнные тельца, которые после окраски могут напоминать эритроциты. Считают, что цист не образует. Патогенное действие в настоящее время отрицается. Обнаруживается в зубном налете здоровых людей в 60-70%. У людей с заболеваниями зубов и полости рта встречается чаще.

Перечень и формы вступительных испытаний

Перечень, формы и программы проведения вступительных испытаний по общеобразовательным предметам для каждой специальности

 

Специальности, направления подготовки Уровень предшествующего образования Форма вступительного испытания Программы вступительных испытаний
Код Наименование
31.05.01 Лечебное дело (очная форма обучения) Среднее (полное) общее образование ЕГЭ
  • Химия (профильный предмет)
  • Биология
  • Русский язык
Высшее профессиональное образование ЕГЭ, Экзамен, проводимый ЧГМА (внутренние испытания)
31.05.02 Педиатрия (очная форма обучения) Среднее (полное) общее образование ЕГЭ
  • Химия (профильный предмет)
  • Биология
  • Русский язык
Высшее профессиональное образование ЕГЭ, Экзамен, проводимый ЧГМА (внутренние испытания)
31.05.03 Стоматология (очная форма обучения) Среднее (полное) общее образование ЕГЭ
  • Химия (профильный предмет)
  • Биология
  • Русский язык
Высшее профессиональное образование ЕГЭ, Экзамен, проводимый ЧГМА (внутренние испытания)

 

Специальности, направления подготовки Уровень предшествующего образования Форма вступительного испытания Программы вступительных испытаний
Код Наименование
31.05.01 Лечебное дело (очная форма обучения) Среднее профессиональное образование ЕГЭ, Экзамен, проводимый ЧГМА (внутренние испытания)
  • Основы теоретической химии (профильный предмет)
  • Основы медицинской биологии
  • Русский язык
31.05.02 Педиатрия (очная форма обучения) Среднее профессиональное образование ЕГЭ, Экзамен, проводимый ЧГМА (внутренние испытания)
  • Основы теоретической химии (профильный предмет)
  • Основы медицинской биологии
  • Русский язык
31.05.03 Стоматология (очная форма обучения) Среднее профессиональное образование ЕГЭ, Экзамен, проводимый ЧГМА (внутренние испытания)
  • Основы теоретической химии (профильный предмет)
  • Основы медицинской биологии
  • Русский язык

 

Амеба — что такое в биологии, строение и жизненный цикл

Мир настолько уникален, что невозможно в нем разобраться, если не изучить хотя бы основы и азы существования. Одним из уникальных объектов животного мира является амеба, изучаемая на уроках биологии в школе.

Амеба – это одноклеточное существо, которое можно встретить в загрязненных водоемах, а также в организме человека, но даже для вооруженного глаза она не всегда заметна. Увидеть такое живое существо подвластно микроскопу.

Большинство людей даже и не задумываются, что, благодаря этому милому одноклеточному существу, люди заболевают кишечными инфекциями, инфекциями ротоглотки, мозга, глаз.

Вконтакте

Facebook

Twitter

Google+

Мой мир

Амеба протей и ее виды

Есть два типа патогенных и непатогенных организмов.

Из первой группы выделяют три основных вида:

  1. Простая амеба – протей (Amoebaproteus) одна из самых простых по внешнему виду особей и самая крупная по размеру.
  2. Дизентерийная амеба является паразитической формой. Встречается в кишечнике и в грязных водоемах.
  3. Кишечная амеба – живет в кишечнике и там питается продуктами жизнедеятельности человека.

Второй тип — непатогенные бактерии, включают в себя большее разнообразие, чем первая группа:

  1. Кишечный паразит — не виден в организме сразу и особого дискомфорта человеку не доставляет.
  2. Бактерия Гартмана не приносит также человеку особого вреда и ее можно определить по более точному исследованию на дисбактериоз.
  3. Карликовый тип — самый миниатюрный из всех его сородичей. Он настолько мал и неподвижен, что его очень трудно диагностировать.
  4. Иодамеба Бючли — схожа по своим характеристикам с дизентерийным видом первого типа.
  5. Диэнтоамеба имеет мутноватый вид, но также является паразитом.

Есть еще ротовая амеба, ее название отвечает само за себя. Живет и размножается во рту у человека и является проблемой большинства заболеваний ротоглотки.

Раковинная амеба

Все амебы также делятся на раковинные и без них. Это связано с их формой. Обычные амебы меняют свою форму, перетекая из одной ножки в другую, а раковинные нет.

Как выглядит обыкновенная амёба

Обычная амеба обитает в загрязненной воде и двигается по дну водоема. Внешне она похожа на брошенную в стену игрушку лизуна, только в несколько тысяч раз уменьшенную в размерах.

Она не имеет скелета, поэтому постоянно видоизменяется. Обычно строение и все функциональные особенности амеб рассматривают на примере амебы протей.

Жизненный цикл

Цикл жизни длится пока существуют благоприятные для этого условия. Но если условия не удовлетворяют, одноклеточное существо впадает в анабиоз – спит и прекращает свою деятельность, превращаясь в кружочек цисту.

Но, как только условия становятся благоприятными, она снова просыпается.

Строение

Данное одноклеточное имеет совершенно простое строение. Кроме ядра и цитоплазмы, которая заполняет ее тело – по сути ничего особенного то и нет.

Есть маленькая вакуоль, которая помогает перерабатывать микроскопические одноклеточные частички (в основном это водоросли) и тем самым продлевать жизненную деятельность амебы.

Есть еще сократительная вакуоль, которая помогает ей двигаться. Снаружи для фиксации тела идет окаймление мембраной – более плотной субстанцией, чем внутри.

Внутренняя часть амебы – это цитоплазма. Она более жидкая и называется эндоплазмой, а ближе к краям она становится гуще и называется эктоплазмой.

Стадии питания амебы

При передвижении амебы в своей среде она наталкивается на микроскопические одноклеточные продукты питания. Они попадают в ее тельце и обволакиваются вакуолью. Далее происходит их переваривание.

Таких вакуолей в тельце амебы может быть несколько. Начинается процесс расщепления одноклеточного на ферменты. Далее расщепленные структуры всасываются внутрь амебы, а после уже происходит выделение.

Размножение

Для размножения амебе не нужен партнер. Она благополучно это делает сама, когда полностью созревает и готова к делению.

Ядро — ее центральная темная часть — меняется по форме и напоминает небольшую сардельку. Через какое-то время сарделька растягивается, и две ее конечные части отделяются друг от друга, образуя две темные капли – это два новых ядра.

После этого амеба также растягивает свое тело посередине и отделяется друг от друга. За 24 часа ее деление может повториться не раз. Так что, в связи с глобальным потеплением и установкой более теплой погоды, во многих водоемах амеба начинает свое колоссальное деление, так как ей ничего не препятствует.

Обмен хромосомами отсутствует, так как и нет полового процесса.

Дыхание

Как многоклеточные животные амеба может дышать. Но специальных функционирующих органов дыхания у нее нет. Она поглощает кислород всем телом. И так же, как все живые организмы, выделяет углекислый газ.

Выделение

После поглощения пищи данное одноклеточное существо выделяет во внешнюю среду продукты своей жизнедеятельности, то есть отходы.

Органы передвижения

Передвигается с помощью маленьких выростов — ложноножек. Эти же выросты помогают в потреблении пищи.

Амёба постоянно меняет свою форму, плавно перетекая то в один, то в другой ее вырост «ножку».

Среда обитания

Может жить в любом водоеме, будь это речка, озеро или болото. Она может жить даже в обыкновенной капле после дождя или росе.

Самой распространенной средой обитания являются загрязненные водоемы. Это могут быть водоемы в африканских и азиатских странах. А также водоемы, граничащие со свалками. Поэтому купаться в таких водоемах нельзя, так как через нос и рот можно занести себе целый букет микроорганизмов.

Есть одно из самых страшных заболеваний нашего века, связанное с невралгией и поражением головного мозга.

Причиной служит амеба-убийца Неглерия Фоулера, ее еще называют мозгопылесосом. Оно не лечится и приводит к летальному исходу. Но такая бактерия редко встречается в нашем климате.

Значение амебы обыкновенной

Прочитав всю информацию, хочется сразу полностью истребить царство паразитов. Но, с одной стороны, это физически невозможно.

С другой стороны, если полностью истребить этот микроорганизм, то будет нарушена биологическая цепочка, и произойдет полный хаос в живом мире.

Пример из реальной жизни: в Китае решили, что воробьи – разносчики инфекций, как у нас голуби. За поимку воробьев давали плату. Таким образом, были уничтожены все воробьи. Начали безумно размножаться всевозможные виды насекомых, которые губили урожай. И после этого китайские власти начали закупать воробьев в других странах, чтобы восстановить экоцепь.

Заключение

Амеба является простейшим одноклеточным существом. Но, несмотря на это, ей присуще многое. Она питается, движется и размножается. Она дышит и чувствует. Её виды настолько разнообразны и удивительны, что можно только восхититься этим миниатюрным существом.

Деление амебы. Амёба обыкновенная

Амеба обыкновенная – вид простейших существ из эукариот, типичный представитель рода Амебы.

Систематика . Вид амебы обыкновенной относится к царству — Животные, типу – Амебозои. Амебы объединены в класс Lobosa и отряд – Amoebida, семейство – Amoebidae, род – Amoeba.

Характерные процессы . Хотя амебы – это простые, состоящие из одной клетки существа, не имеющие никаких органов, им присущи все жизненно необходимые процессы. Они способны передвигаться, добывать пищу, размножаться, поглощать кислород, выводить продукты обмена.

Строение

Амеба обыкновенная – одноклеточное животное, форма тела неопределенная и изменяется из-за постоянного перемещения ложноножек. Размеры не превышают половины миллиметра, а снаружи ее тело окружено мембраной – плазмалемой. Внутри располагается цитоплазма со структурными элементами. Цитоплазма представляет собой неоднородную массу, где выделяют 2 части:

  • Наружная – эктоплазма;
  • внутренняя, с зернистой структурой – эндоплазма, где сосредоточены все внутриклеточные органеллы.

У амебы обыкновенной имеется крупное ядро, которое расположено примерно в центре тела животного. Оно имеет ядерный сок, хроматин и покрыто оболочкой, имеющей многочисленные поры.

Под микроскопом видно, что амеба обыкновенная образует псевдоподии, в которые переливается цитоплазма животного. В момент образования псевдоподии в нее устремляется эндоплазма, которая на периферических участках уплотняется и превращается в эктоплазму. В это время на противоположном участке тела эктоплазма частично превращается в эндоплазму. Таким образом, в основе образования псевдоподий лежит обратимое явление превращения эктоплазмы в эндоплазму и наоборот.

Дыхание

Амеба получает O 2 из воды, который диффундирует во внутреннюю полость через наружные покровы. Все тело участвует в дыхательном акте. Кислород, попавший в цитоплазму, необходим для расщепления питательных веществ на простые составляющие, которые Amoeba proteus сможет переварить, а еще для получения энергии.

Среда обитания

Обитает в пресной воде канав, небольших прудов и болот. Может жить также в аквариумах. Культуру амебы обыкновенной можно легко разводить в лабораторных условиях. Она является одной из крупных свободноживущих амеб, достигающих 50 мкм в диаметре и видимых невооруженным глазом.

Питание

Амеба обыкновенная передвигается с помощью ложноножек. Она преодолевает один сантиметр за пять минут. Передвигаясь, амебы наталкиваются на различные мелкие объекты: одноклеточные водоросли, бактерии, мелких простейших и т.д. Если объект достаточно мал, амеба обтекает его со всех сторон и он, вместе с небольшим количеством жидкости, оказывается внутри цитоплазмы простейшего.


Схема питания амебы обыкновенной

Процесс поглощения твердой пищи амебой обыкновенной называется фагоцитозом. Таким образом, в эндоплазме образуются пищеварительные вакуоли, внутрь которых из эндоплазмы поступают пищеварительные ферменты и происходит внутриклеточное пищеварение. Жидкие продукты переваривания проникают в эндоплазму, вакуоль с непереваренными остатками пищи подходит к поверхности тела и выбрасывается наружу.

Кроме пищеварительных вакуолей в теле амеб находится и так называемая сократительная, или пульсирующая, вакуоль. Это пузырек водянистой жидкости, который периодически нарастает, а достигнув определенного объема, лопается, опорожняя свое содержимое наружу.

Основная функция сократительной вакуоли — регуляция осмотического давления внутри тела простейшего. В связи с тем, что концентрация веществ в цитоплазме амебы выше, чем в пресной воде, создается разность осмотического давления внутри и вне тела простейшего. Поэтому пресная вода проникает в организм амебы, но ее количество остается в пределах физиологической нормы, поскольку пульсирующая вакуоль «откачивает» избыток воды из тела. Подтверждением этой функции вакуоли служит их наличие только у пресноводных простейших. У морских она или отсутствует, или сокращается очень редко.

Сократительная вакуоль кроме осморегуляторной функции частично выполняет и выделительную функцию, выводя вместе с водой в окружающую среду продукты обмена веществ. Однако основная функция выделения осуществляется непосредственно через наружную мембрану. Известную роль играет, вероятно, сократительная вакуоль в процессе дыхания, ибо проникающая в результате осмоса в цитоплазму вода несет растворенный кислород.

Размножение

Амебам свойственно бесполое размножение, осуществляемое путем деления надвое. Этот процесс начинается с митотического деления ядра, которое продольно удлиняется и перегородкой разъединяется на 2 самостоятельные органеллы. Они отдаляются и формируют новые ядра. Цитоплазма с оболочкой делится с помощью перетяжки. Сократительная вакуоль не разделяется, а попадает в одну из новообразованных амеб, во второй вакуоль формируется самостоятельно. Размножаются амебы достаточно быстро, за день процесс деления может происходить несколько раз.

В летний период времени амебы растут и делятся, но с приходом осенних холодов, из-за пересыхания водоемов, трудно найти питательные вещества. Поэтому амеба превращается в цисту, оказавшись в критических условиях и покрывается прочной двойной белковой оболочкой. При этом цисты легко распространяются за ветром.

Значение в природе и жизни человека

Amoeba proteus — важное составляющее экологических систем. Она регулирует численность бактериальных организмов в озерах и прудах. Очищает водную среду от чрезмерного загрязнения. Также является важным составляющим пищевых цепочек. Одноклеточные – еда для маленьких рыб и насекомых.

Ученые используют амебу как лабораторное животное, проводя на ней множество исследований. Очищает амеба не только водоемы, но поселившись в человеческом организме, она поглощает разрушенные частицы эпителиальной ткани пищеварительного тракта.

Амеба-протей — это одноклеточное животное, сочетающий в себе функции клетки и самостоятельного организма. Внешне обыкновенная амеба напоминает маленький студенистый комочек размером всего 0,5 мм, постоянно меняющий свою форму из за того, что амеба постоянно образует выросты — так называемые ложноножки, и как бы перетекает с места на место.

За такую изменчивость формы тела амебе обыкновенной и дали имя древнегреческого бога Протея, который умел изменять свой облик.

Строение амебы

Организм амебы состоит из одной клетки, и содержит цитоплазму, окруженную цитоплазматической мембраной. В цитоплазме находится ядро и вакуоли — сократительная вакуоль, выполняющая функции органа выделения, и пищеварительная вакуоль, служащая для переваривания пищи. Наружный слой цитоплазмы амебы более плотный и прозрачный, внутренний — более текучий и зернистый.

Амеба протей живет на дне небольших пресных водоемов — в прудах, лужах, канавах с водой.

Питание амебы

Питается амеба обыкновенная другими одноклеточными животными и водорослями, бактериями, микроскопическими остатками умерших животных и растений. Перетекая по дну, амеба наталкивается на добычу, и обволакивает ее со всех сторон с помощью ложноножек. При этом вокруг добычи образуется пищеварительная вакуоль, в которую из цитоплазмы начинают поступать пищеварительные ферменты, благодаря которым пища переваривается и затем всасывается в цитоплазму. Пищеварительная вакуоль перемещается к поверхности клетки в любом месте, и сливается с клеточной оболочкой, после чего открывается наружу, и непереваренные остатки пищи выбрасываются во внешнюю среду. Переваривание пищи в одной пищеварительной вакуоли занимает у амебы протея от 12 часов до 5 дней.

Выделение

В процессе жизнедеятельности любого организма, в том числе и у амебы, образуются вредные вещества, которые должны выводиться наружу. Для этого у амебы обыкновенной имеется сократительная вакуоль, в которую из цитоплазмы постоянно поступают растворенные вредные продукты жизнедеятельности. После того, как сократительная вакуоль наполнится, она перемещается к поверхности клетки и выталкивает содержимое наружу. Этот процесс повторяется постоянно — ведь сократительная вакуоль наполняется за несколько минут. Вместе с вредными веществами в процессе выделения удаляется также избыток воды. У простейших, живущих в пресной воде, концентрация солей в цитоплазме выше, чем во внешней среде, и вода постоянно поступает в клетку. Если лишнюю воду не удалять, клетка просто лопнет. У простейших же, живущих в соленой, морской воде сократительной вакуоли нет, у них вредные вещества удаляются через наружную мембрану.

Дыхание

Амеба дышит растворенным в воде кислородом. Как это происходит и для чего необходимо дыхание? Для того, чтобы существовать, любому живому организму нужна энергия. Если растения получают ее в процессе фотосинтеза, используя энергию солнечного света, то животные получают энергию в результате химических реакций окисления органических веществ, поступивших с пищей. Главным участником этих реакций является кислород. У простейших кислород поступает в цитоплазму через всю поверхность тела и участвует в реакциях окисления, при этом и выделяется необходимая для жизнедеятельности энергия. Кроме энергии, образуется углекислый газ, вода и некоторые другие химические соединения, которые затем выделяются из организма.

Размножение амебы

Амебы размножаются бесполым путем, с помощью деления клетки надвое. При этом сначала делится ядро, затем внутри амебы появляется перетяжка, которая делит амебу на две части, в каждой из которых находится по ядру. Затем по этой перетяжке части амебы разделяются друг от друга. Если условия благоприятные, то амеба делится примерно раз в сутки.

В неблагоприятных условиях, например, при пересыхании водоема, похолодании, изменении химического состава воды, а также осенью амеба превращается в цисту. Тело амебы при этом становится округлым, ложноножки исчезают, и ее поверхность покрывается очень плотной оболочкой, защищающей амебу от высыхания и других неблагоприятных условий. Цисты амебы легко переносятся ветром, и таким образом происходит заселение амебами других водоемов.

Когда условия внешней среды становятся благоприятными, амеба выходит из цисты и начинает вести обычный, активный образ жизни, питаться и размножаться.

Раздражимость

Раздражимость – это свойство всех животных реагировать на различные воздействия (сигналы) внешней среды. У амебы раздражимость проявляется способностью реагировать на свет – амеба уползает от яркого света, а также на механическое раздражение и изменение концентрации соли: амеба уползает в сторону, противоположную от механического раздражителя или от помещенного рядом с ней кристаллика соли.

Один из представителей одноклеточных животных (простейших), имеющих возможность самостоятельно передвигаться, используя так называемые «ложноножки» называется – Амеба обыкновенная или протей. Относится к типу корненожек из-за своего непостоянного вида, образующихся, изменяющихся и исчезающих ложноножек.

Она имеет форму маленького, еле различимого невооруженным глазом студенистого комочка, не имеющего цвета, размером около 0,5 мм, главная характеристика которого изменчивость формы, отсюда и название – «амеба», значит «изменчивая».

Детально рассмотреть строение клетки обыкновенной амебы без микроскопа невозможно.

Любой водоем с пресной стоячей водой – идеальная среда обитания для амебы, особенно предпочитает пруды с большим содержанием гниющих растений и болота, в которых обитают в большом количестве бактерии.

При этом она сможет выжить во влаге почвы, в капле росы, в воде внутри человека, и даже в обычный гниющий лист дерева может приметить амёба, амёбы, другими словами напрямую зависят от воды.

Наличие большого количества микроорганизмов и одноклеточных водорослей, явный признак присутствия протея в воде, так как она ими питается.

Когда наступают отрицательные условия для существования (наступление осени, пересыхание водоема), простейшее перестает питаться. Приобретая форму шарика, на теле одноклеточного появляется специальная оболочка – циста. Внутри этой пленки организм может находиться продолжительное время.

В состоянии цисты клетка пережидает засуху или холода (при этом простейшее не перемерзает и не засыхает), пока условия окружения не изменятся или циста не будет перенесена ветром в более благоприятное место, жизнь клетки амебы останавливается.

Так защищается от неблагоприятных условий амеба обыкновенная, когда среда обитания становится пригодной для жизни, протей выходит из оболочки и продолжает вести обычный образ жизни.

Существует способность к регенерации, когда тело повреждено, она может достроить разрушенное место, главное условие для этого процесса – целостность ядра.

Строение и обмен веществ простейшего


Чтобы рассмотреть внутреннее строение организма одноклеточного, необходим микроскоп. Он позволит увидеть, что строение тела амебы, представляет собой целый организм, который в состоянии самостоятельно выполнить все функции необходимые для выживания.

Ее тело покрыто тонкой пленкой, которая называется , и содержащая полужидкую цитоплазму. Внутренний слой цитоплазмы более жидкий и менее прозрачный, чем наружный. В ней находятся ядро и вакуоли

Для пищеварения и избавления не переваренных остатков используется пищеварительная вакуоль. начинает осуществляться с контакта с пищей, на поверхности тела клетки появляется «пищевая чашечка». Когда стенки «чашечки» смыкаются, туда поступает пищеварительный сок, так появляется пищеварительная вакуоль.

Образовавшиеся питательные вещества в результате пищеварения используются для построения тела протея.

Процесс пищеварения может занимать от 12 часов до 5 дней. Такой тип питания называется фагоцитоз. Чтобы дышать, простейшее поглощает воду всей поверхностью тела, из которой потом выделяет кислород.

Для выполнения функции выделения излишков воды, а также регулирования давления внутри тела, у амебы имеется сократительная вакуоль, через нее также иногда может происходить выделение продуктов жизнедеятельности. Так происходит дыхание амебы, процесс называется – пиноцитоз.

Передвижение и реакция на раздражители


Для передвижения амеба обыкновенная использует ложноножку, другое их название – псевдоподия или корненожка (из-за сходства с корнями растений). Они могут образовываться в любом месте на поверхности тела. Когда цитоплазма переливается к краю клетки, на поверхности протея появляется выпуклость, образуется ложная ножка.

В нескольких местах ножка прикрепляется к поверхности, в нее постепенно перетекает оставшаяся цитоплазма.

Таким образом, происходит передвижение, скорость которого примерно 0,2 мм в минуту. Клетка может образовать несколько псевдоподий. Организм реагирует на различные раздражители, т.е. обладает способностью чувствовать.

Размножение


Питаясь, клетка растет, увеличивается, наступает процесс, ради которого живут все существа – размножение.

Размножение амебы обыкновенной, процесс самый простой из известных науке, происходит бесполым путем, и подразумевает собой деление на части. Размножение начинается со стадии, когда ядро амебы начинает вытягиваться и сужаться посередине пока не разделится на две части. В это время тело самой клетки так же разделяется. В каждой из этих частей остаётся по ядру.

В конце концов, цитоплазма между двумя частями клетки разрывается, и образующийся новый клеточный организм отделяется от материнского, в котором остается сократительная вакуоль. Стадия деления обусловлена еще тем, что протей перестает питаться, останавливается пищеварение, тело приобретает округлый вид.

Таким образом, размножается протей. В течение суток клетка может размножаться несколько раз.

Значение в природе


Являясь важным элементом любой экосистемы, амеба обыкновенная регулирует количество бактерий и микроорганизмов в среде ее обитания. Тем самым поддерживая чистоту водоемов.

Таким образом, являясь частью пищевой цепочки, ею питаются мелкие рыбки, рачки и насекомые для которых она является пищей.

Тело амёбы протей (рис. 16) покрыто плазматической мембраной . Всеми дей-ствиями амебы руководит ядро . Цитоплазма находится в постоянном движении. Если её микропотоки устремляются к одной точке поверхности амебы, там появляется выпя-чивание. Оно увеличивается в размерах, становится вы-ростом тела. Это ложноножка, которая прикрепляется к частицам ила. В нее постепенно перетекает все содержимое амебы. Так происходит передвижение амебы с места на место.

Амеба протей — всеядное животное. Ее пищу составляют бактерии , одноклеточные растения и живот-ные, а также разлагающиеся органические частицы . Пере-двигаясь, амеба наталкивается на пищу и обтекает ее со всех сторон и та оказывается в цитоплазме (рис. 16). Во-круг пищи формируется пищеварительная вакуоль, куда поступают пищеварительные секреты, переваривающие пи-щу . Такой способ захвата пищи называется клеточным заглатыванием.

Амеба может питаться и жидкой пищей, используя другой способ — клеточное питье. Происходит это так. Снаружи внутрь цитоплазмы впячивается тонкая трубочка, в которую засасывается жидкая пища. Вокруг нее обра-зуется пищеварительная вакуоль.

Рис. 16. Строение и питание амебы

Выделение

Как и у бодо, вакуоль с непереваренными остатками пищи перемещается к поверхности тела амебы и ее содер-жимое выбрасывается наружу. Выделение вредных веществ жизнедеятельности и из-бытка воды происходит при помощи сокра-тительной (пульсирующей) вакуоли.

Дыхание

Дыхание у амебы осуществляется так же, как у бодо (см. Бодо — животное жгутиконосец ).

Каждый вид простейших животных имеет свое строение, свою форму, в том числе и очень сложную и причудливую. Она образуется не случайно, и сохраняется очень долго: на дне океана в отложениях, образовавшихся десятки миллионов лет назад, находят точно такие же раковины фораминифер.

Такое возможно потому, что у каждого вида построение организма осуществляется по определенному плану, опре-деленной программе. Эта программа записана особым ко-дом на длинных молекулах, хранящихся в ядре клетки , точно так же, как программы для компьютера записывают на магнитном жестком диске. Перед размножением с программы списывается копия, и передается потомству. Эти программы можно называть генетически закрепленными, или врожденными. Материал с сайта

Ядро клетки содержит не только программы, как ее построить, но и как действовать. Они определяют действия животного — его поведение . Подобно тому, как у одних простейших программы построения формы тела приводят к простой форме, а у других к сложной, так и программы поведения могут быть и простыми, и сложными. Разно-образие животных по сложности программы поведения не меньше, чем разнообразие их форм.

Амеба тоже реагирует на многие сигналы, запуская свои программы поведения. Так, она распознает разные виды микроскопических организмов, служащих ей пищей; уходит от яркого света; определяет концентрацию веществ в среде обитания; уходит от постоянного механического раздражения.

Происхождение саркодовых

В пре-делах жгутиконосцев проходит зыбкая граница (отличи-тельная черта) между двумя царствами — растениями и животными. На первый взгляд кажется, что между жи-вотными жгутиконосцами и саркодовыми имеется резкое различие: первые передвигаются при помощи жгутиков, вторые — с использованием ложноножек. Но оказывается, что саркодовые, считавшиеся ранее древнейшими простей-шими, ныне рассматриваются как эволюционные потомки животных жгутиконосцев. Дело в том, что у многих сар-кодовых во время размножения появляются жгутики, как, например, у половых клеток радиолярий и фораминифер. Следовательно, жгутики когда-то были и у саркодовых. Более того, известны животные жгутиконосцы (например, жгутиковая амеба), принимающие форму амебы для за-хвата пищи при помощи ложноножек. Все это позволяет считать, что саркодовые произошли от древних жгутиконосцев и утратили жгутики при дальнейшей эво-люции.

На этой странице материал по темам:

  • Ложноножки амебы это

  • Систематика амебы протей

  • Сообщение на тему амёба протей

  • Амебы протея реферат

  • Общее строение амебы протей

Вопросы по этому материалу:

Амеба обыкновенная внешне представляет собой клетку, имеет непосредственное отношение к типу простейших, к классу корненожек, или еще их называют Саркодовыми. У них имеются ложноножки, являющиеся органами, с помощью которых они передвигаются и захватывают пищу. Плотная оболочка у клетки отсутствует, в связи, с чем амеба может запросто менять свою форму. Наружное покрытие — очень тонкая цитоплазматическая мембрана.

Амеба обыкновенная строение.

Амеба очень просто устроена. Одно из самых простейших живых существ. Не имеет скелета. Амеба обыкновенная обитает на дне различных водоемов, в иле. Есть одно но: в водоемах только пресных: пруд, канава и т.п. Если взглянуть на нее, то заметно, что этот серенький прозрачный комочек не имеет постоянной формы. Название этого существа переводится как «изменчивая». На теле клетки все время образуются ложноножки, из-за того, что цитоплазма перетекает туда и сюда. Размеры комочка могут быть, как минимум, 0,2 миллиметра и, как максимум, 0,7 миллиметров. Органоиды — ложноножки способствуют движению этого крошечного существа. Движение очень медленное, оно напоминает перетекание густой слизи. В процессе движения амеба наталкивается на разные одноклеточные организмы, такие как водоросли, бактерии. Она обтекает их и как бы всасывает собственной цитоплазмой, при этом образуется пищеварительная вакуоль.

Амеба обыкновенная цитоплазмой выделяет специфические ферменты, которые переваривают пищу. Происходит процесс внутриклеточного пищеварения. Переваренные продукты в жидком виде поступают в саму цитоплазму, а непереваренные остатки пищи — выбрасываются. Этот способ захвата пиши носит название фагоцитоза. В теле амебы имеются тонкие каналы, по которым поступает жидкость в тело клетки. Этот процесс носит название пиноцитоза. Есть в наличии одна вакуоль, выбрасывающая излишки жидких продуктов наружу. Она называется Избавляется от излишков через каждые пять минут. В эндоплазме имеется ядро. Размножение происходит следующим образом: клетка делится пополам, то есть бесполым путем.

Как амеба отгораживается от неблагоприятного воздействия извне.

Амеба обыкновенная и дизентерийная амеба являются Передвигаются с помощью органоидов-ложноножек, принадлежат к корненожкам;

Класс корненожек походит на водоросли, что свидетельствует об их родстве;

Питается доставшимися от других растений, либо от других что и отличает амебу их от водорослей.

Амеба — хоть и простейший, но целый организм, способный вести самостоятельное существование.

Амёба как простейший организм: её строение, способ размножения, животное это или бактерия

Царство Животные
Подцарство Одноклеточные
Тип Корненожки
Род Амёбы

К подцарству Одноклеточные относятся животные, тело которых состоит всего из одной клетки, большей частью микроскопического размера, но со всеми присущими организму функциями. В физиологическом отношении эта клетка представляет целый самостоятельный организм.

Двумя основными компонентами тела одноклеточных являются цитоплазма и ядро (одно или несколько). Цитоплазма окружена наружной мембраной.

Она имеет два слоя: наружный (более светлый и плотный) — эктоплазму — и внутренний — эндоплазму.

В эндоплазме находятся клеточные органоиды: митохондрии, эндоплазматическая сеть, рибосомы, элементы аппарата Гольджи, различные опорные и сократительные волокна, сократительные и пищеварительные вакуоли и др.

Среда обитания и внешнее строение обыкновенной амёбы

Простейшее живёт в воде. Это может быть и вода озера, и капля росы, и влага почвы, и даже вода внутри нас. Поверхность тела их очень нежная и без воды моментально высыхает. Внешне амёба похожа на сероватый студенистый комочек (0,2-05 мм), не имеющий постоянной формы.

Движение

Амёба «перетекает» по дну. На теле постоянно образуются меняющие свою форму выросты — псевдоподии (ложноножки). В один из таких выступов постепенно переливается цитоплазма, ложная ножка в нескольких точках прикрепляется к субстрату и происходит передвижение.

Внутреннее строение

Внутреннее строение амебы

Питание

Передвигаясь, амёба наталкивается на одноклеточные водоросли, бактерии, мелкие одноклеточные, «обтекает» их и включает в цитоплазму, образуя пищеварительную вакуоль.

Питание амебы

Ферменты, расщепляющие белки, углеводы и липиды, поступают внутрь пищеварительной вакуоли, и происходит внутриклеточное пищеварение. Пища переваривается и всасывается в цитоплазму. Способ захвата пищи с помощью ложных ножек называется фагоцитозом.

Дыхание

Кислород расходуется на клеточное дыхание. Когда его становится меньше, чем во внешней среде, новые молекулы проходят внутрь клетки.

Дыхание амебы

Молекулы углекислого газа и вредных веществ, накопившихся в результате жизнедеятельности, наоборот, выходят наружу.

Выделение

Пищеварительная вакуоль подходит к клеточной мембране и открывается наружу, чтобы непереваренные остатки выбросить наружу в любом участке тела.

Жидкость поступает в тело амёбы по образующимся тонким трубковидным каналам, путём пиноцитоза. Откачиванием лишней воды из организма занимаются сократительные вакуоли.

Они постепенно наполняются, а раз в 5-10 минут резко сокращаются и выталкивают воду наружу. Вакуоли могут возникать в любой части клетки.

Размножение

Амёбы размножаются только бесполым путём.

Размножение амебы

Выросшая амёба приступает к размножению. Оно происходит путём деления клетки. До деления клетки ядро удваивается, чтобы каждая дочерняя клетка получила свою копию наследственной информации (1). Размножение начинается с изменения ядра.

Оно вытягивается (2), а затем постепенно удлиняется (3,4) и перетягивается посредине. Поперечной бороздкой делится на две половинки, которые расходятся в разные стороны — образуются два новых ядра. Тело амёбы разделяется на две части перетяжкой и образуется две новые амёбы.

В каждую из них попадает по одному ядру (5). Во время деления происходит образование недостающих органоидов.

В течение суток деление может повторяться несколько раз.

Бесполое размножение — простой и быстрый способ увеличить число своих потомков. Этот способ размножения не отличается от деления клеток при росте тела многоклеточного организма. Разница в том, что дочерние клетки одноклеточного организма, расходятся, как самостоятельные.

Реакция на раздражение

Амёба обладает раздражимостью — способностью чувствовать и реагировать на сигналы из внешней среды. Наползая на предметы, она отличает съедобные от несъедобных и захватывает их ложноножками. Она уползает и прячется от яркого света (1),

механических раздражений и повышенной концентрации, вредных для нее веществ (2).

Такое поведение, состоящее в движении к раздражителю или от него, называется таксисом.

Половой процесс

Отсутствует.

Переживание неблагоприятных условий

Одноклеточное животное очень чувствительно к изменениям окружающей среды.

В неблагоприятных условиях (при высыхании водоёма, в холодное время года) амёбы втягивают псевдоподии. На поверхность тела из цитоплазмы выделяются значительное количество воды и вещества, которые образуют прочную двойную оболочку. Происходит переход в покоящееся состояние — цисту (1). В цисте жизненные процессы приостанавливаются.

Цисты, разносимые ветром, способствуют расселению амебы.

При наступлении благоприятных условиях амёба покидает оболочку цисты. Она выпускает псевдоподии и переходит в активное состояние (2-3).

Ещё одна форма защиты — способность к регенерации (восстановлению). Повреждённая клетка может достроить свою разрушенную часть, но только при условии сохранения ядра, так как там хранится вся информации о строении.

Жизненный цикл амёбы

Жизненный цикл амёбы прост. Клетка растёт, развивается (1) и делится бесполым путём (2). В плохих условиях любой организм может «временно умереть» — превратиться в цисту (3). При улучшении условий он «возвращается к жизни» и усиленно размножается.

Жизненный цикл амёбы

Источник: https://biouroki.ru/material/animals/ameba.html

Строение амебы обыкновенной: внешнее и внутреннее с рисунками и подписями


Рейтинг статьи:
(3 голоса, в среднем: 5 из 5)

Амеба обыкновенная (протей) является представителем класса Саркодовые свободноживущие. Отличается примитивной организацией и строением, может перемещаться, используя небольшие наросты на оболочке – цитоплазмы. Представляет собой одноклеточный, независимый и полноценный организм.

Внешнее строение тела амебы

Внешне амеба выглядит как полужидкий комочек размером 0,2-0,7 мм. Ее можно увидеть, используя микроскоп, чтобы рассмотреть крупную особь можно использовать увеличительное стекло. Весь организм покрыт цитоплазмой, закрывающей студенистое ядро. При движении цитоплазма изменяет форму – вытягивается в одну и другую сторону.

Что же делать в такой ситуации ? Для начала советуем почитать эту статью. В данной статье подробно описываются методы борьбы с паразитами. Также рекомендуем обратиться к специалисту. Читать статью >>>

Амеба формирует небольшие отростки для передвижения питания. С помощью ложноножек способна отталкиваться от поверхностей. Для передвижения она вытягивает ложноножку в нужном направлении, а после перетекает в нее. Скорость перемещения организма составляет примерно 10 мм в час.

Отсутствие скелета позволяет организму принимать нужную форму, изменять ее при необходимости. В организме нет органа отвечающего за поставку кислорода – дыхание осуществляется при помощи всего тела.

Во время передвижений, тело амеба впитывает большое количество жидкости, чтобы избавиться от излишков применяется сократительная вакуоль, которая лопается и выталкивает воду, затем снова формируется.

У нее также отсутствуют органы чувств, однако она всячески пытается спрятаться от попадания прямых солнечных лучей. Проявляет чувствительность к внешним раздражителям, определенным химическим веществам.

Внутреннее строение

Внутреннее строение амебы можно увидеть с помощью микроскопа. Она представляет собой цельный организм, способный выполнять все функции для выживания. Тело ее покрыто полужидкой цитоплазматической мембраной. Внутренний слой состоит из более жидкой и не такой прозрачной цитоплазмы. Внутри находится ядро с вакуолями.

Пищеварительная вакуоль помогает избавиться от пищеварительных отходов. При контакте с пищей, на теле бактерии образуется «пищевая чашечка», которая обеспечивает питание. Когда она смыкается, внутрь проникает пищеварительный сок, благодаря чему образовывается пищеварительная вакуоль.

Важно! Полученные в процессе питания вещества, помогают развивать строение тела организма.

Вакуоль с пищей перемещается к краю, соединяется с мембраной, вследствие чего происходит освобождение от пищевых отходов. Процесс питания называют фагоцитозом, пищеварительные процессы занимают период от 12 часов до 5 дней. Поглощенная всем телом вода образует кислород. Процесс дыхания называется пиноцитоз.

Строение цисты амебы

Дриц Ирина Александровна. Врач-паразитолог

Гельминтозы могут привести к многочисленным проблемам со здоровьем, сокращающие жизнь на 15-25 лет. Многие паразиты крайне трудно обнаружимы. Они могут быть где угодно — в крови, кишечнике, легких, сердце, мозге. Симптомы глистной инвазии можно спутать с ОРВИ, болезнями ЖКТ и другими. Основная ошибка в таких случаях — затягивание! Если у вас есть подозрения на наличие паразитов, то нужно обратиться к специалисту. Если же говорить о лекарствах и самостоятельном лечении, то от наиболее распространенных гельминтов (аскарид, остриц, цепней) подойдет этот антипаразитный комплекс.

Процесс жизнедеятельности (питания, размножения) амебы происходит летом. С наступлением холодов она прекращает питаться, тело приобретает округлую форму, поверхность покрывается плотной защитной оболочкой – цистой.

Бактерия проживают в прудах, когда они высыхают, их тело также покрывается цистой. Такая оболочка помогает пережить неблагоприятные для амебы условия. Когда окружающая ситуация улучшается, она покидает цисту, продолжает жизнь в благоприятных условиях.

Циста кишечной амебы отличается овальной, круглой формой, может содержать небольшой запас питательных веществ. В разные периоды развития имеет 1-8 ядер. Выходят из организма амеба с калом, когда циста попадает в благоприятные условия, она лопается и продолжает жизнедеятельность.

Амеба протея – это простой одноклеточный организм. В подавляющем большинстве проживает в соленых и пресных водоемах. Имеет примитивное строение тела, которое обеспечивает организм всеми необходимыми для существования процессами.

Антипаразитарный комплекс® — Надежное и безопасное избавление от паразитов за 21 день!

  • В состав входят только природные компоненты;
  • Не вызывает побочных эффектов;
  • Абсолютно безопасен;
  • Защищает от паразитов печень, сердце, легкие, желудок, кожу;
  • Выводит из организма продукты жизнедеятельности паразитов.
  • Эффективно уничтожает большую часть видов гельминтов за 21 день.

Сейчас действует акция на бесплатную упаковку.

Здравствуйте, читатели сайта о паразитах Noparasites.ru. Меня зовут Александр Лигнум. Я автор данного сайта. Мне 23 года, я студент 5 курса Кемеровского государственного медицинского института. Специализация «Паразитолог». Подробнее об авторе>>

Лучшие истории наших читателей

Тема: Во всех бедах виноваты паразиты!

От кого: Людмила С. ([email protected])

Кому: Администрации Noparasites.ru

Не так давно мое состояние здоровья ухудшилось. Начала чувствовать постоянную усталость, появились головные боли, лень и какая-то бесконечная апатия. С ЖКТ тоже появились проблемы: вздутие, понос, боли и неприятный запах изо рта.

Думала, что это из-за тяжелой работы и надеялась, что само все пройдет. Но с каждым днем мне становилось все хуже. Врачи тоже ничего толком сказать не могли. Вроде как все в норме, но я-то чувствую, что мой организм не здоров.

Решила обратиться в частную клинику. Тут мне посоветовали на ряду с общими анализами, сдать анализ на паразитов. Так вот в одном из анализов у меня обнаружили паразитов. По словам врачей – это были глисты, которые есть у 90% людей и заражен практически каждый, в большей или меньшей степени.

Мне назначили курс противопаразитных лекарств. Но результатов мне это не дало. Через неделю мне подруга прислала ссылку на одну статью, где какой-то врач паразитолог делился реальными советами по борьбе с паразитами. Эта статья буквально спасла мою жизнь. Я выполнила все советы, что там были и через пару дней мне стало гораздо лучше!

Улучшилось пищеварение, прошли головные боли и появилась та жизненная энергия, которой мне так не хватало. Для надежности, я еще раз сдала анализы и никаких паразитов не обнаружили!

Кто хочет почистить свой организм от паразитов, причем неважно, какие виды этих тварей в вас живут — прочитайте эту статью, уверена на 100% вам поможет! Перейти к статье>>>

Остались вопросы? Задайте их в нашей Анонимной группе в ВК
© Александр Лигнум
Поиск лекрств от паразитов

Источник: https://NoParasites.ru/protozojnye-organizmy/stroenie-ameby-obyknovennoj.html

Амеба | Биология

Амебы — это род одноклеточных организмов-эукариот (относятся к простейшим). Считаются животноподобными, так как питаются гетеротрофно.

Строение амеб обычно рассматривают на примере типичного представителя — амебы обыкновенной (амебы протея).

Амеба обыкновенная (далее амеба) обитает на дне пресноводных водоемов с загрязненной водой. Ее размер колеблется от 0,2 мм до 0,5 мм. По внешнему виду амеба похожа на бесформенный бесцветный комок, способный менять свою форму.

Клетка амебы не имеет жесткой оболочки. Она образует выпячивания и впячивания. Выпячивания (цитоплазматические выросты) называют ложноножками или псевдоподиями.

Благодаря им амеба может медленно двигаться, как бы перетекая с места на место, а также захватывать пищу.

Образование ложноножек и перемещение амебы происходит за счет движения цитоплазмы, которая постепенно перетекает в выпячивание.

Хотя амеба одноклеточный организм и не может быть речи об органах и их системах, ей свойственны почти все процессы жизнедеятельности, характерные для многоклеточных животных. Амеба питается, дышит, выделяет вещества, размножается.

Цитоплазма амебы не однородна. Выделяют более прозрачный и плотный наружный слой (эктоплазма) и более зернистый и жидкий внутренний слой цитоплазмы (эндоплазма).

В цитоплазме амебы находятся различные органеллы, ядро, а также пищеварительная и сократительная вакуоли.

Питается амеба различными одноклеточными организмами и органическими остатками. Пища обхватывается ложноножками и оказывается внутри клетки, образуется пищеварительная вакуоль.

В нее поступают различные ферменты, расщепляющие питательные вещества. Те, которые нужны амебе, потом поступают в цитоплазму.

Ненужные остатки пищи остаются в вакуоли, которая подходит к поверхности клетки и из нее все выбрасывается.

«Органом» выделения у амебы является сократительная вакуоль. В нее поступают излишки воды, ненужные и вредные вещества из цитоплазмы. Заполненная сократительная вакуоль периодически подходит к цитоплазматической мембране амебы и выталкивает наружу свое содержимое.

Дышит амеба всей поверхностью тела. В нее из воды поступает кислород, из нее — углекислый газ. Процесс дыхания заключается в окислении кислородом органических веществ в митохондриях. В результате выделяется энергия, которая запасается в АТФ, а также образуются вода и углекислый газ. Энергия, запасенная в АТФ, далее расходуется на различные процессы жизнедеятельности.

Для амебы описан только бесполый способ размножения путем деления надвое. Делятся только крупные, т. е. выросшие, особи. Сначала делится ядро, после чего клетка амебы делится перетяжкой. Та дочерняя клетка, которая не получает сократительную вакуоль, образует ее впоследствии.

С наступлением холодов или засухи амеба образует цисту. Цисты имеет плотную оболочку, выполняющую защитную функцию. Они достаточно легкие и могут разноситься ветром на большие расстояния.

Амеба способна реагировать на свет (уползает от него), механическое раздражение, наличие в воде определенных веществ.

Источник: https://biology.su/zoology/amoeba

Амеба: фото, строение, жизненный цикл и способ передвижения

Самый простейший организм – амеба протей, хотя существуют разные виды амеб. Свое название она получила в честь Протея – персонажа греческой мифологии, особенностью которого было менять свою внешность.

Существо – прокариот, поскольку это не бактерия, как думает множество людей. Это бесцветный организм гетеротрофного типа, эукариот, который способен питаться микроорганизмами и одноклеточными водорослями.

Несмотря на свою простоту и короткий жизненный цикл, этот тип животного играет важную роль в природе.

Описание

Согласно классификации, амебу обыкновенную относят к царству «Животные», подцарству «Простейшие», классу свободноживущих саркодовых. Строение существа примитивное, а передвигается оно благодаря временно появляющимся выпячиваниям цитоплазмы (называют еще корненожка). Тело протей состоит всего лишь из единственной клетки, являющейся независимым и полноценным организмом.

Основная среда обитания амебы – болотистая и влажная почва, водоемы (как соленые, так и пресные), гниющие пруды, населенные множеством бактерий. Также обитает в организме человека и животных (это паразитирующая разновидность). Жить амебный организм может и в аквариумной воде. Животное без труда размножается в лабораторных условиях.

Строение и морфологические формы

Амёба обыкновенная – эукариот, одноклеточное независимое животное. Характеристика его такова: тело полужидкое, размер достигает 0,2-0,7 мм в длину, и хорошо разглядеть существо можно только под микроскопом.

По всей поверхности амебная клетка покрыта цитоплазмой, защищающей собой «внутренности». Сверху находится цитоплазматическая оболочка. У амебы строение цитоплазмы – двухслойное. Внешний слой – прозрачный и плотный, внутренний ‑ зернистый и текучий.

В цитоплазме располагаются сократительная вакуоль амебы (за счет нее происходит выделение ненужных веществ наружу), ядро и пищеварительная вакуоль. При движении постоянно меняется форма цитоплазмы.

Исследовав изображения, ученые определили, что у Протея более пятисот хромосом, настолько мелких, что за ними нет возможности наблюдать.

Дыхание осуществляется всем телом. Скелет отсутствует. Размножение амебы бесполое. Органом чувств (в том числе дыхания) амебная клетка также не располагает.

Тем не менее, одноклеточная амеба дышит, чувствительна к химическим веществам, раздражителям механического типа и избегает солнечных лучей.

Одно из особенностей животного – способность к регенерации. Это означает, что в случае повреждения клетка сможет самостоятельно восстановиться, достроив отсутствующие фрагменты. Единственное условие – полное сохранение ядра, поскольку оно является носителем всех информационных данных о строении. Без ядра амебный организм просто погибнет.

Передвижение амеб происходит при помощи ложноножек, так называемых непостоянных выростов цитоплазмы, которые еще именуют псевдоподиями. Мембрана клетки очень эластична и способна растягиваться в любом месте.

Чтобы образовать ложноножку, сначала происходят выпячивания цитоплазмы наружу тела, так, чтобы они выглядели наподобие толстых щупалец. После – выполняются те же действия, только в обратном порядке – цитоплазма движется внутрь, ложноножка прячется и появляется в другой части тела.

Именно такой способ передвижения не дает животному иметь постоянную форму тела. Несмотря на малый размер, передвигаются существа сравнительно быстро – около 10 мм/час.

Амеба двигается при помощи ложноножек, именно поэтому она не имеет постоянную форму тела

Как питаются и дышат одноклеточные?

Амебный жизненный цикл полностью зависит от того, как питается животное и какова окружающая среда. В рацион протея входят остатки гниения, одноклеточные водоросли, бактерии, а также микроорганизмы, имеющие подходящий размер.

Питание амебы происходит путем захвата «добычи» ложноножками и затягивания внутрь тела. Вокруг пищи формируется вакуоль, в которую затем и поступает пищеварительный сок.

Интересно то, что процесс захватывания и дальнейшее переваривание могут происходить в любом участке тела и даже в нескольких частях одновременно. Получаемые при переваривании питательные вещества попадают в цитоплазму и расходуются на построение тела амебы.

В процессе рассасывания водорослей и бактерий простейшие незамедлительно выводят наружу остатки жизнедеятельности, причем это может также происходить любым участком цитоплазмы.

Как и все простейшие класса одноклеточных, у протей отсутствуют специальные органеллы. Дыхание у амебы происходит за счет поглощения растворенного в воде (или жидкости) кислорода поверхностным аппаратом. Клеточная мембрана животного проницаема, и через нее свободно проходят углекислый газ и кислород.

Как размножаются?

Для вывода потомства используется бесполое размножение с разделением тела на две одинаковые части. Подробнее, сколько стадий проходит клетка при делении.

Процесс происходит только в теплую пору и включает в себя несколько стадий:

  1. Первым делом делению подвергается ядро. Оно выпячивается, растягивается, в нем появляются перетяжки, с помощью которых затем и происходит деление на две совершенно идентичные части. При этом наблюдается расхождение дочерних хромосом к противоположным полюсам материнской клетки.
  2. Далее происходит разделение цитоплазмы между двумя ядрами. Ее зоны располагаются и сосредотачиваются вокруг ядер, тем самым формируя две новые клетки.
  3. Поскольку в теле амебы сократительная вакуоль имеется только в единичном экземпляре, она достается лишь одной новой клетке. В другой она формируется заново. Подробнее описание процесса деления и расхождения хромосом демонстрирует рисунок.

Деление клетки таким способом называется митозом, поэтому полученные два организма являются копией «мамы». Половой процесс отсутствует, поэтому обмен хромосом также не происходит.

Размножаются обыкновенные амебы очень быстро. Если судить по времени, существо каждые 3 часа делится на 2 клетки, поэтому живет амебный организм мало.

Особенности существования и развития

Жизненный цикл прост. Единственная клетка, являющаяся по совместительству и телом животного, в процессе развития растет, а по достижению взрослого состояния «размножается», делясь на два тела бесполым путем с расхождением материнских хромосом «детям».

Попадая в негативные для жизни условия (холодное время года, высыхание водоема), такая клетка способна «умереть» на время.

При этом тело претерпевает изменения: псевдоподии втягиваются, из цитоплазмы выделяется вода и покрывает весь амебный организм, образуя двойную оболочку с последующим формированием цисты. Протея «замирает».

Когда окружающая среда станет пригодной для жизни, существо «возрождается», циста амебы вскрывается, выпускаются ложноножки (чтобы передвигаться), и существо размножается. Подробно узнать, что такое амеба, можно на видео.

Животное имеет огромное значение в природе. Оно – источник еды многоклеточных организмов (амёбами питаются черви, ракообразные, мальки рыб, различные моллюски). Обитающая в водоемах протея в процессе жизни очищает водоемы, поедая различного типа микроорганизм, бактерии и гниющие части водорослей, простейшие раковинные амебы участвуют в формировании меловых отложений и известняков.

Источник: https://TrutenStop.ru/protozojnye/ameba

Обыкновенная амёба

Амёба протей или амёба обыкновенная – лат. Amoeba proteus, относится к типу простейшие одноклеточные организмы.

Строение обыкновенной амёбы

Амёбы обладают довольно простым строением тела. Если рассматривать амёбу под микроскопом, то можно заметить, что она состоит из студенистого вещества, то есть протоплазмы и ядра внутри. Из курса ботаники известно, что протоплазма с ядром внутри образует клетку. Значит, амёбу обыкновенную смело можно назвать одноклеточным организмом, состоящую из протоплазмы и ядра внутри.

Форма тела обыкновенной амёбы постоянно варьируется, отсюда и такое название «амёба», что в переводе с греческого языка – «изменчивая». Изменение формы тела происходит за счёт вытягивающихся ложноножек, служащие для передвижения и захвата частичек пищи.

Обитание обыкновенной амёбы

Амёбы протей широко распространены по всему земному шару, чаще всего встречаются в пресных водоёмах и аквариумах, но также можно обнаружить в лужах и канавах. Амёбы обыкновенные могут выживать даже в самых неблагоприятных условиях.

Если условия жизни ухудшаются, например, при высыхании водоёма, амёбы покрываются специальной оболочкой называемой цистой, которая может переносить как высокие температуры (до +60 градусов), так и низкие (до -273 градусов). Если условия жизни улучшается, то амёба снова начинает перемещаться и питаться.

Что делает амёб и других простейших одноклеточных одними из самых выживаемых организмов на планете.

Передвижение амёбы обыкновенной

Передвижение амёбы осуществляется за счёт так называемых ложноножек, которые могут появляться в любом месте тела амёбы.

При перемещении ложноножки вытягиваются в соответствии с направлением движения амёбы, и постепенно в вытянутый отросток (ложноножку) переливается протоплазма амёбы, тем самым создавая движение по поверхности.

Как правило, во время перемещения у обыкновенной амёбы появляется несколько отростков (ложноножек) отличающиеся по форме и размерам. Разнообразность в размерах и форме связано с отсутствием оболочки у амёбы протей.

Питание обыкновенной амёбы

Обыкновенная амёба питается при помощи специальных вытягивающихся отростков или ложноножек, и благодаря которым, как говорилось выше осуществляет перемещение.

При попадании пищи через ложноножки в протоплазму, вокруг частички пищи образуется капля жидкости, называемая пищеварительной вакуолью.

В пищеварительные вакуоли протоплазма выделяет пищеварительные соки, под действием которых пища переваривается. Не переваренные частички пищи выводятся наружи в любом месте протоплазмы.

Амёба обыкновенная или амёба протей питается микроскопическими грибами, бактериями и водорослями.

Дыхание амёбы протей

Помимо питания, амёбам также, как и всем живым организмам необходим кислород. Если переместить амёбу в кипячёную воду, можно заметить, что через некоторое время обыкновенная амёба погибает из-за нехватки кислорода. Отсюда можно сделать вывод, что амёбы из воды усваивают кислород и выделяют углекислый газ.

Дыхание амёбы осуществляется всей поверхностью тела, за счёт появляющегося внутри тела, сократительного пузырька или вакуоли. Которая периодически то увеличивается, то уменьшается, либо вовсе исчезает.

Сократительная вакуоль после усвоения кислорода состоит из воды и растворённого в ней углекислого газа и различного рода ненужных для амёбы протей веществ.

При сокращении пузырька эти вещества и углекислый газ выводятся наружу.

Размножение обыкновенной амёбы

Размножение происходит за счёт деления клетки. Во время деления обыкновенная амёба перестаёт перемещаться, также исчезает сократительная вакуоль. При размножении ядро амёбы сначала немного удлиняется и после делится пополам. Далее делится протоплазма. В результате появляются две дочерние амёбы, которые за короткий промежуток времени вырастают до размеров взрослой амёбы.

Источник: http://scibio.ru/biologiya/stati/amjoba_obyknovennaya.html

Скажите плиз движение, питание, выделение, дыхание, размножение, образование цист: Амёбы, Эвглены-зелёной, Инфузории-туфельки

— adele — Знаток (468) 7 лет назад Саркодовые имеют наиболее примитивную организацию. Они передвигаются с помощью ложноножек — временных выростов цитоплазмы. Представителем класса Саркодовых свободноживущих может быть амеба обыкновенная (Amoeba proteus) (рис. 80). Строение. Обитает амеба обыкновенная в прудах, канавах с илистым дном.

Размеры тела амебы достигают 0,2 — 0,7 мм. Тело амебы покрыто цитоплазматической мембраной, за которой идет слой прозрачной плотной эктоплазмы. Далее располагается полужидкая эндоплазма, составляющая основную массу амебы. В цитоплазме есть ядро.

Цитоплазма находится в непрерывном движении, в результате которого возникают цитоплазматические выросты — псевдоподии, или ложноножки. Псевдоподии служат для передвижения и для поглощения частиц пищи. Питание. Амеба охватывает пищевые частицы (бактерии, водоросли) ложноножками и втягивает их внутрь тела. Вокруг бактерий образуются пищеварительные вакуоли.

В них благодаря ферментам происходит переваривание пищи. Вакуоли с непереваренными остатками подходят к поверхности тела, и эти остатки выбрасываются наружу (рис. 81). 131 Рис. 80. Амеба.

1 — пищеварительная вакуоль с заглоченным пищевой частицей; 2 — выделительная (сократительная) вакуоль; 3 — ядро; 4 — пищеварительная вакуоль; 5 — псевдоподии; 6 — эндоплазма; 7 — эктоплазма. Рис. 81. Питание и движение амебы. 132 Выделение. Жидкие продукты диссимиляции выделяются через сократительную, или пульсирующую вакуоль.

Вода из окружающей среды поступает в тело амебы осмотически через наружную мембрану. Концентрация веществ в теле амебы выше, чем в пресной воде. Это создает разность осмотического давления внутри и вне тела простейшего. Сократительная вакуоль периодически удаляет избыток воды из тела амебы. Промежуток между двумя пульсациями равен 1-5 мин.

Сократительная вакуоль выполняет также функции осморегуляции и дыхания. Дыхание. Амеба дышит растворенным в воде кислородом всей поверхностью тела. Насыщенная диоксидом углерода вода удаляется из организма через сократительную вакуоль. Размножение. Амеба размножается бесполым путем — делением на два. Сначала втягиваются псевдоподии и амеба округляется.

Затем происходит деление ядра митозом. На теле амебы появляется перетяжка, которая перешнуровывает его на две равные части. В каждую из них отходит по одному ядру (рис. 82).

При наступлении холодов, осенью амеба инцистируется — покрывается плотной защитной оболочкой. Цисты разносятся ветром, что способствует расселению амебы (рис. 83).

Данила Кулаков Знаток (390) 2 года назад Ваня Шевель Ученик (169) 2 года назад Артемий Спицын Знаток (278) 2 года назад Оксана Тыщенко Знаток (279) 2 года назад Бучковсий Александр 8Е Ученик (177) 2 года назад Саркодовые имеют наиболее примитивную организацию. Они передвигаются с помощью ложноножек — временных выростов цитоплазмы. Представителем класса Саркодовых свободноживущих может быть амеба обыкновенная (Amoeba proteus) (рис. 80). Строение. Обитает амеба обыкновенная в прудах, канавах с илистым дном. Размеры тела амебы достигают 0,2 — 0,7 мм. Тело амебы покрыто цитоплазматической мембраной, за которой идет слой прозрачной плотной эктоплазмы. Далее располагается полужидкая эндоплазма, составляющая основную массу амебы. В цитоплазме есть ядро.

Цитоплазма находится в непрерывном движении, в результате которого возникают цитоплазматические выросты — псевдоподии, или ложноножки. Псевдоподии служат для передвижения и для поглощения частиц пищи. Питание. Амеба охватывает пищевые частицы (бактерии, водоросли) ложноножками и втягивает их внутрь тела. Вокруг бактерий образуются пищеварительные вакуоли.

В них благодаря ферментам происходит переваривание пищи. Вакуоли с непереваренными остатками подходят к поверхности тела, и эти остатки выбрасываются наружу (рис. 81). 131 Рис. 80. Амеба.

1 — пищеварительная вакуоль с заглоченным пищевой частицей; 2 — выделительная (сократительная) вакуоль; 3 — ядро; 4 — пищеварительная вакуоль; 5 — псевдоподии; 6 — эндоплазма; 7 — эктоплазма. Рис. 81. Питание и движение амебы. 132 Выделение. Жидкие продукты диссимиляции выделяются через сократительную, или пульсирующую вакуоль.

Вода из окружающей среды поступает в тело амебы осмотически через наружную мембрану. Концентрация веществ в теле амебы выше, чем в пресной воде. Это создает разность осмотического давления внутри и вне тела простейшего. Сократительная вакуоль периодически удаляет избыток воды из тела амебы. Промежуток между двумя пульсациями равен 1-5 мин.

Сократительная вакуоль выполняет также функции осморегуляции и дыхания. Дыхание. Амеба дышит растворенным в воде кислородом всей поверхностью тела. Насыщенная диоксидом углерода вода удаляется из организма через сократительную вакуоль. Размножение. Амеба размножается бесполым путем — делением на два. Сначала втягиваются псевдоподии и амеба округляется.

Затем происходит деление ядра митозом. На теле амебы появляется перетяжка, которая перешнуровывает его на две равные части. В каждую из них отходит по одному ядру (рис. 82).

При наступлении холодов, осенью амеба инцистируется — покрывается плотной защитной оболочкой. Цисты разносятся ветром, что способствует расселению амебы (рис. 83).

Артём Власов Ученик (203) 1 год назад Среда обитания, строение и передвижениеИнфузория-туфелька обитает в мелких стоячих водоёмах. Это одноклеточное животное длиной 0,5 мм имеет веретеновидную форму тела, отдалённо напоминающую туфлю. Инфузории все время находятся в движении, плавая тупым концом вперёд. Скорость передвижения этого животного достигает 2,5 мм в секунду. На поверхности тела у них имеются органоиды движения — реснички. В клетке два ядра: большое ядро отвечает за питание, дыхание, движение, обмен веществ; малое ядро участвует в половом процессе.Строение инфузории туфелькиОрганизм инфузории устроен сложнее. Тонкая эластичная оболочка, покрывающая инфузорию снаружи, сохраняет постоянную форму её тела. Этому же способствуют хорошо развитые опорные волоконца, которые находятся в прилегающем к оболочке слое цитоплазме. На поверхности тела инфузории расположено около 15 000 колеблющихся ресничек. У основания каждой реснички лежит базальное тельце. Движение каждой реснички состоит из резкого взмаха в одном направлении и более медленного, плавного возвращения к исходному положению. Реснички колеблются примерно 30 раз в секунду и, словно вёсла, толкают инфузорию вперёд. Волнообразное движение ресничек при этом согласованно. Когда инфузория-туфелька плывёт, она медленно вращается вокруг продольной оси тела.Процессы жизнедеятельностиПитаниеТуфелька и некоторые другие свободно живущие инфузории питаются бактериями и водорослями.Реакция инфузории-туфельки на пищуТонкая эластичная оболочка, (клеточная мембрана) покрывающая инфузорию снаружи, сохраняет постоянную форму тела. На поверхности тела расположено около 15 тысяч ресничек. На теле имеется углубление — клеточный рот, который переходит в клеточную глотку. На дне глотки пища попадает в пищеварительную вакуоль. В пищеварительной вакуоле пища переваривается в течение часа, вначале при кислой, а затем при щелочной реакции. Пищеварительные вакуоли перемещаются в теле инфузории током цитоплазмы. Не переваренные остатки выбрасываются наружу в заднем конце тела через особую структуру — порошицу, расположенную позади ротового отверстия.ДыханиеДыхание происходит через покровы тела. Кислород поступает в цитоплазму через всю поверхность тела и окисляет сложные органические вещества, в результате чего они превращаются в воду, углекислый газ и некоторые другие соединения. При этом освобождается энергия, которая необходима для жизни животного. Углекислый газ в процессе дыхания удаляется через всю поверхность тела.ВыделениеВ организме инфузории-туфельки находятся две сократительные вакуоли, которые располагаются у переднего и заднего концов тела. В них собирается вода с растворёнными веществами, образующимися при окислении сложных органических веществ. Достигнув предельной величины, сократительные вакуоли подходят к поверхности тела, и их содержимое изливается наружу. У пресноводных одноклеточных животных через сократительные вакуоли удаляется избыток воды, постоянно поступающей в их тело из окружающей среды.РаздражимостьИнфузории-туфельки собираются к скоплениями бактерий в ответ на действие выделяемых ими веществ, но уплывают от такого раздражителя, как поваренная соль.Раздражимость — свойство всех живых организмов отвечать на действия раздражителей — света, тепла, влаги, химических веществ, механических воздействий. Благодаря раздражимости одноклеточные животные избегают неблагоприятных условий, находят пищу, особей своего года.РазмножениеБесполоеИнфузория обычно размножается бесполым путём — делением надвое. Ядра делятся на две части, и в каждой новой инфузории оказывается по одному большому и по одному малому ядру. Каждая из двух дочерних получает часть органоидов, а другие образуются заново.Размножение инфузории-туфелькиПоловое

При недостатке пищи или изменении температуры инфузории переход

Елена Ушицина Ученик (197) 10 месяцев назад К подцарству Одноклеточные относятся животные, тело которых состоит всего из одной клетки, большей частью микроскопического размера, но со всеми присущими организму функциями. В физиологическом отношении эта клетка представляет целый самостоятельный организм.Двумя основными компонентами тела одноклеточных являются цитоплазма и ядро (одно или несколько). Цитоплазма окружена наружной мембраной. Она имеет два слоя: наружный (более светлый и плотный) — эктоплазму — и внутренний — эндоплазму. В эндоплазме находятся клеточные органоиды: митохондрии, эндоплазматическая сеть, рибосомы, элементы аппарата Гольджи, различные опорные и сократительные волокна, сократительные и пищеварительные вакуоли и др.Среда обитания и внешнее строение обыкновенной амёбыПростейшее живёт в воде. Это может быть и вода озера, и капля росы, и влага почвы, и даже вода внутри нас. Поверхность тела их очень нежная и без воды моментально высыхает. Внешне амёба похожа на сероватый студенистый комочек (0,2-05 мм), не имеющий постоянной формы.ДвижениеАмёба «перетекает» по дну. На теле постоянно образуются меняющие свою форму выросты — псевдоподии (ложноножки). В один из таких выступов постепенно переливается цитоплазма, ложная ножка в нескольких точках прикрепляется к субстрату и происходит передвижение.Внутреннее строениеВнутреннее строение амебыПитаниеПередвигаясь, амёба наталкивается на одноклеточные водоросли, бактерии, мелкие одноклеточные, «обтекает» их и включает в цитоплазму, образуя пищеварительную вакуоль.Питание амебыФерменты, расщепляющие белки, углеводы и липиды, поступают внутрь пищеварительной вакуоли, и происходит внутриклеточное пищеварение. Пища переваривается и всасывается в цитоплазму. Способ захвата пищи с помощью ложных ножек называется фагоцитозом.ДыханиеКислород расходуется на клеточное дыхание. Когда его становится меньше, чем во внешней среде, новые молекулы проходят внутрь клетки.Дыхание амебыМолекулы углекислого газа и вредных веществ, накопившихся в результате жизнедеятельности, наоборот, выходят наружу.ВыделениеПищеварительная вакуоль подходит к клеточной мембране и открывается наружу, чтобы непереваренные остатки выбросить наружу в любом участке тела. Жидкость поступает в тело амёбы по образующимся тонким трубковидным каналам, путём пиноцитоза. Откачиванием лишней воды из организма занимаются сократительные вакуоли. Они постепенно наполняются, а раз в 5-10 минут резко сокращаются и выталкивают воду наружу. Вакуоли могут возникать в любой части клетки.РазмножениеАмёбы размножаются только бесполым путём.Размножение амебыВыросшая амёба приступает к размножению. Оно происходит путём деления клетки. До деления клетки ядро удваивается, чтобы каждая дочерняя клетка получила свою копию наследственной информации (1). Размножение начинается с изменения ядра. Оно вытягивается (2), а затем постепенно удлиняется (3,4) и перетягивается посредине. Поперечной бороздкой делится на две половинки, которые расходятся в разные стороны — образуются два новых ядра. Тело амёбы разделяется на две части перетяжкой и образуется две новые амёбы. В каждую из них попадает по одному ядру (5). Во время деления происходит образование недостающих органоидов.В течение суток деление может повторяться несколько раз.Бесполое размножение — простой и быстрый способ увеличить число своих потомков. Этот способ размножения не отличается от деления клеток при росте тела многоклеточного организма. Разница в том, что дочерние клетки одноклеточного организма, расходятся, как самостоятельные.Реакция на раздражение

Амёба обладает раздражимостью — способностью чувствовать и реагировать на сигналы из внешней среды. Наползая на предметы, она отличает съедобные от несъедобных и захватывает их ложноножками.

Источник: https://otvet.mail.ru/question/79922012

Бактерия и амеба – что общего и в чем отличия?

Разнообразие одноклеточных форм жизни на Земле поражает. Несмотря на свои малые размеры, существует огромное разнообразие их и существенные различия в строении, форме, способности образовывать колонии, фотосинтезировать, способах передвижения.

Бактерии, зеленые водоросли (например, эвглена зеленая и инфузория туфелька), амеба, грибы, актиномицеты, нитчатые водоросли, архебактерии демонстрируют широкое разнообразие строения и форм, давая возможность исследователям постоянно находиться в состоянии поиска и регулярно находить что-то новенькое в микроскопическом мире.

В морях микроорганизмы составляют 90% всей биомассы. Без них было бы невозможным существование других, более высокоорганизованных форм морских жителей. В пробах грунта со дна Марианской впадины (точнее – из разлома Челленджера), взятых в 2002 году японским батискафом, были найдены 13 видов микроорганизмов, ранее не известных науке.

Их возраст составляет более 1 миллиарда лет, а строение аналогично найденным ранее в других регионах (России, Швеции, Австрии) «неведомым биологическим окаменелостям». Японские специалисты считают, что эти бактерии являются древнейшими из сохранившихся жителей Земли.

Их фото, сделанные под электронным микроскопом, свидетельствуют о том, что это бактерии.

Эукариоты и прокариоты – разница только в наличии ядра?

Все живые организмы принято делить на две большие группы исходя из строения их ядер, содержащих наследственную информацию. Это эукариоты и прокариоты.

Прокариоты

Организмы, не имеющие оформленных ядер и оформленных мембранных структур внутри клеток, способные передавать генетическую информацию кольцевыми молекулами ДНК, которые называются плазмидами.

Они отличаются высоким уровнем горизонтальной и вертикальной изменчивости и устойчивостью к неблагоприятными условиям среды.

В этой группе обнаружено большое количество организмов-экстремалов, приспособленных к жизни:

  • в горячих источниках,
  • при отрицательных температурах,
  • в средах с высоким содержанием солей,
  • при низкой освещенности,
  • при отсутствии кислорода.

Отличаются разнообразными видами питания, используют в качестве источника питательных веществ мертвую органику, минеральные вещества, соединения азота, серы, водорода. Способны к хемо- и фотосинтезу. Существует целая группа фотосинтезирующих цианобактерий, у которых этот процесс происходит в мембранных комплексах – тилакоидах и схож с фотосинтезом эукариот.

В этой группе выделяют бактерии (или эубактерии) и архебактерии. Основные отличия между ними состоят в строении мембран и белковых цепочек. Последние больше напоминают эукариотические.

Многие бактерии – водные жители, при отсутствии воды образуют споры и пережидают неблагоприятный период. Некоторые формируют пленки и наросты на камнях, входят в состав лишайников. Являются древнейшими жителями нашей планеты.

Самыми древними признаны термоацидофилы – архебактерии горячих источников, гибнущие при температуре ниже +55ºС.

Эукариоты

Все остальные организмы на Земле имеют в своих клетках оформленное ядро, за что и получили свое название. Кроме того, внутри их клеток имеются:

  • оформленные мембранные структуры – митохондрии, осуществляющие энергетические процессы;
  • хлоропласты, где проходит фотосинтез;
  • комплекс Гольджи;
  • вакуоли.

Сюда относятся такие классические микроорганизмы, как амеба, инфузория туфелька, эвглена зеленая и другие водоросли. Интересно, что ученые до сих пор не пришли к согласию о принадлежности одноклеточных водорослей.

До сих пор ботаники считают, что это растение, а зоологи – что животное. Как и бактерии, одноклеточные водоросли инфузория туфелька, эвглена и амеба – водные жители.

Только водоросли способны жить в толще воды, а амеба для передвижения требует твердого субстрата.

Амебы и их маленькие безъядерные жертвы: сходство, различия

Бактерии и амебы – частая причина желудочно-кишечных недомоганий у человека и животных. Некоторые из них имеют сходные симптомы, однако лечение их выполняется различными препаратами. Обнаружение возбудителя болезни помогает назначить пациенту эффективное лечение – в противном случае болезнь может превратиться в хроническую, чреватую регулярными обострениями.

Кого относят к амебам

Амеба – одноклеточное существо, способное передвигаться при помощи образования специальных выпячиваний цитоплазмы, называемых ложноножками. Это дает ей возможность свободно перемещаться по твердым поверхностям, хотя скорость этого передвижения весьма невелика. Фото этих необычных клеток дает возможность больше узнать об их строении и способе питания.

Амеба – настоящий хищник, и поедает бактерии и мелкие одноклеточные водоросли, получая энергию для жизни через усвоение их органических веществ.

Прожорливая амеба способна поглощать и переваривать объекты, значительно большие, чем она, по размеру.

В этом случае вся клетка на время превращается в большую пищеварительную вакуоль (что-то похожее на змею, которая съела слона в сказке о Маленьком Принце) и на время теряет свою подвижность.

В неблагоприятных условиях амеба образует цисты, что делает ее жизненный цикл схожим с таковым у бактерии. Некоторые амебы способны образовывать защитные раковины, накапливая для их создания необходимые вещества в специальных вакуолях.

Проживая в кишечнике животных, амеба питается готовой мертвой органикой или живыми бактериями и не наносит вреда организму хозяина.

Однако дизентерийная амеба, появившись в просвете кишечника, ведет себя как настоящий агрессор, уничтожая нормальную микрофлору и являясь причиной нарушений работы кишечника.

Интересно, что по способу передвижения и питания на амеб очень похожи иммунные клетки животных – макрофаги. По внешнему виду макрофаг – амеба, получившая постоянную «прописку» в многоклеточной системе и за это выполняющая функцию поглощения чужеродных клеток.

Представители бактерий

Не имеют настоящих ядер, существенно меньше по линейным размерам и часто являются пищевой базой для амеб. Если судить по фото, сделанным под электронным микроскопом, их клеточная оболочка жесткая и препятствует выпячиванию цитоплазмы.

Бактерии способны вызывать кишечные расстройства, эффективность которых зависит от их чувствительности к конкретным антибиотикам. Устойчивость к лекарствам в бактериальной популяции может передаваться от клетки к клетке при помощи кольцевых плазмид, осуществляющих так называемый горизонтальный перенос генов между клетками.

Недавние исследования позволили обнаружить бактерии в самых невероятных местах нашей планеты. Мир облетели фото затопленных золотых рудников ЮАР, где были обнаружены живые бактерии Firmicutes. Ученые утверждают, что энергию эти организмы берут из урановых руд.

В условиях отсутствия солнца они занимают нишу фотосинтезирующих бактерий, являясь источником первичных органических веществ, служащих питательной средой для остальных глубинных и подземных жителей.

Они способны разлагать воду на кислород и водород и образовывать сульфаты из других соединений серы, придавая им удобный для усвоения другими организмами вид.

Фото, сделанные учеными в различных местах обитания микроорганизмов, демонстрируют их огромное разнообразие. Безусловно, бактерии держат пальму первенства по своей численности и по обширности доступных для их проживания зон.

Являясь первыми колонистами минеральных отложений, они дают возможность в дальнейшем селиться там другим организмам – как одноклеточным, так и более сложным.

Некоторые бактерии становятся неотъемлемой частью уникальных пейзажей Земли, окрашивая воду в синие, зеленые или красные тона, создавая причудливые цветные лишайники в самых невероятных местах. Фото этих мест свидетельствуют о том, что жизнь без одноклеточных организмов на Земле была бы невозможна.

Работаю врачом ветеринарной медицины. Увлекаюсь бальными танцами, спортом и йогой. В приоритет ставлю личностное развитие и освоение духовных практик. Любимые темы: ветеринария, биология, строительство, ремонт, путешествия. Табу: юриспруденция, политика, IT-технологии и компьютерные игры.

Источник: https://probakterii.ru/prokaryotes/raznoe/bakterii-ameba.html

Простейшие одноклеточные животные и их признаки (Таблица)

К подцарству Одноклеточных, или Простейших, относят животных, тело которых состоит из одной клетки. Размеры простейших в среднем 0,1—0,5 мм. Бывают особи ещё меньшей величины — около 0,01 мм. Встречаются и довольно крупные организмы, длиной в несколько миллиметров и даже сантиметров.

Обитают простейшие одноклеточные животные преимущественно в жидкой среде — в морской и пресной воде, влажной почве, в других организмах. Внешне они весьма разнообразны. Одни напоминают бесформенные студенистые комочки (например, амёбы), другие имеют геометрически правильную форму (например, лучевики).

Простейшие насчитывает около 30 тысяч видов.

Строение инфузории туфельки и амебы

   

Строение эвглены зеленой

Таблица признаки простейших одноклеточных животных

Признаки простейших одноклеточных Амеба обыкновенная
(Класс Корненожки)
Эвглена зеленая
(класс Жгутиконосцы)
Инфузория ту­фелька
(класс Ин­фузории)
Строение Состоит из цитоплазмы, ядра, сократительной вакуоли, ложноножки, пищеварительной вакуоли (см. рис) Состоит из оболочки, ядра, жгутика, глазок, сократительной вакуоли, питательных веществ, хлоропласты (см. рис.) Состоит из мембраны, малого и большого ядра, сократительной и пищеварительной вакуоли, рот, порошица, реснички (см. рис.)
Движение «Перетекание» с по­мощью ложноножек Передвижение с помощью жгутика Передвижение с помощью рес­ничек
Питание Кормом могут быть бактерии, микроскопические водоросли. Амёба захватывает пищу, вытягивая ложноножки на любом участке тела. Они обволакивают добычу и вместе с небольшим количеством воды погружают её в цитоплазму. Так образуется пищеварительная вакуоль — фагоцитоз, за­хват капель жидкости — пиноцитоз.
Из пищеварительной вакуоли растворимые продукты пищеварения поступают в цитоплазму, а непереваренные остатки выводятся из организма в любой части клетки.
Автотрофное (фото­синтез) или гетеро­трофное (фагоцитоз и пиноцитоз) Питаются различными микроорганизмами, преимущественно бактериями. Движением ресничек, расположенных вдоль ротового углубления, загоняют в него добычу. Вместе с водой она попадает в клеточный рот, затем в глотку. Образуется пищеварительная вакуоль, непере­варенные остатки выбрасываются через порошицу.
Размноже­ние Амеба размножается делением. При этом ядро делится надвое. Образовавшиеся новые ядра расходятся в стороны, и между ними появляется поперечная перетяжка, разделяющая амёбу на две дочерние клетки, которые живут самостоятельно. Через некоторое время молодые амёбы также начинают делиться. Для размножения благоприятна температура воды около +20 °С. Размножение организмов данного вида эвглен бесполое — делением клетки пополам, в отличие от инфузории-туфельки, для которой характерен еще и половой процесс. Инфузории размножаются бесполым путём — поперечным делением, как амёбы. Первым делится надвое малое ядро, затем большое. Одновременно появляется поперечная перетяжка. Она со временем разделяет инфузорию на две молодые (дочерние) клетки. Они растут и при хорошем питании и оптимальной температуре уже на следующие сутки становятся взрослыми и снова могут делиться.
Для инфузорий характерен и половой процесс в форме конъюгации (слия­ние двух клеток и обмен генети­ческой информа­цией)

_______________

Источник информации: Биология в таблицах и схемах./ Издание 2е, — СПб.: 2004.

Источник: https://infotables.ru/biologiya/37-biologiya-zhivotnykh/412-odnokletochnye-zhivotnye-tip-prostejshie-ikh-priznaki-tablitsa

строение, дыхание, питание, размножение > Лаборатория фитоинвазий

Урок-экскурсия по биологии на тему «Мир растений малой родины». 6-й класс

Содержание урока позволяет углубить знания учащихся о многообразии растений Алтайского края. Экскурсия развивает интерес к предмету, познавательные способности, навыки общения, коллективного взаимодействия (работа в группах и парах). Больший упор сделан на растения школьного дендрария. Предлагается презентация….

01 11 2021 15:34:17

Мультимедийный урок в форме игры «Поле чудес»

Урок нацелен познакомить учащихся с часто применяемыми лекарственными растениями. В игровой занимательной форме обобщить представления о многообразии и лекарственном значении растений родного края….

01 11 2021 10:24:38

Естественный отбор: значение, источники и классификация

Естественный отбор — процесс, обеспечивающий выживание сильных особей, которые передают благоприятные признаки следующим поколениям, при этом неблагоприятные свойства подвергаются элиминации. Естественный отбор действует на уровне популяции….

01 11 2021 19:42:37

Задания с рисунками ЕГЭ по биологии

В перспективе с целью реализации компетентностного подхода в контрольные измерительные материалы Е Г Э будут включены ситуативные задачи, проверяющие способности школьников, их интеллект, понимание жизненных ситуаций, умение логически мыслить и принимать грамотные решения. …

01 11 2021 6:58:15

Урок по теме «Питание растений. Особенности воздушного питания растений»

Урок разработан для учащихся 6-го класса. Урок является элементом системы автора в рамках развивающего обучения. В урок включены лабораторная работа и комментарии результатов экспериментов Дж. Пристли и Ван Гельмонта. Кроме того, урок включает чтение по ролям басни И. А. Крылова » Листы и корни». Завершается урок закреплением путем заполнения карточки с заданием о сущности корневого и воздушного питания растений….

01 11 2021 23:34:46

Природоведение в 5-м классе. Урок-игра «Через тернии – к звездам»

Представлен конспект урока-игры в 5-м классе: » Через тернии — к Звездам». Эта игра проводится после изучения главы » Вселенная». Игра — одна из форм проведения обобщающего урока в моей педагогической практике. Практически каждая пройденная глава в 5-х и 6-х классах обобщается именно в игровой форме. Игра побуждает учащихся к знаниям, к победе, учит коллективной форме работы, определенным правилам и нормам поведения, а главное — прививает интерес к предмету….

01 11 2021 5:42:28

Программа элективного курса по биологии «Основы цитологии и генетики»

Программа предназначена для учителей биологии, преподающих в 10–11-х классах естественнонаучного профиля (химико-биологическая или биолого-географическая специализация), в качестве элективного курса. Необходимость в разработке программы возникла в связи с тем, что существует вполне определенный «разрыв» в усвоении знаний по цитологии и генетике на основе школьной программы и требованиями со стороны программ для поступления в вузы….

01 11 2021 14:15:46

Урок по теме «Строение и работа сердца», 8-й класс

Комбинированный урок с постановкой проблемного вопроса и применением активных форм обучения. Решение задач по теме « Работа сердца» и активное участие учащихся в изучении нового материала позволяет им самостоятельно сделать выводы по уроку и ответить на проблемный вопрос. …

01 11 2021 20:51:50

Смотр знаний по теме «Скелет человека»

По своей структуре – это обобщающий, проблемно-развивающий урок. Проводится в нетрадиционной форме – предоставление отчета о проделанной работе в ходе экспедиции. Урок построен на материале ранее изученном и вся работа организуется с опорой на уже полученные знания. Содержание урока активизирует внимание, способствует выдвижению проблем и нахождению путей доказательств и формулировке выводов….

01 11 2021 4:34:27

Урок биологии «Видообразование. Результаты микроэволюции»

Представленный урок » Видообразование. Результаты микроэволюции», проведённый в 11-х классе, направлен на комплексное повторение и закрепление знаний учащихся об эволюционных процессах популяций, повторение генетики (полиплоидия, гибридизация, хромосомные мутации). Учащиеся получают представление о путях, типах и скорости видообразования. Постоянно ставятся проблемные вопросы, проводится связь нового материала с ранее изученным, его сравнение, обобщение. На основе наводящих вопросов ребята самостоятельно формируют выводы, умело связывают теоретический материал с практикой жизни….

01 11 2021 20:34:26

Урок в 7-м классе по теме «Класс пресмыкающихся. Их многообразие и общие черты»

Цель урока — проследить эволюцию пресмыкающихся; выяснить, какие отряды, кроме ранее изученных, входят в состав класса; определить основные черты представителей класса. На уроке обобщаются знания по особенностям внешнего строения пресмыкающихся, выясняется, от каких животных произошли древние пресмыкающиеся и какие изменения произошли в их организме….

01 11 2021 3:37:56

Интегрированный урок (химия + биология) «Железы внутренней секреции»

Особенностью представленного урока является его интеграция с предметом » Химия», предметом, который учащиеся 8-го класса только начали изучать. Цель данного типа интеграции: развитие познавательного интереса к предмету » Химия», подтверждение единства наук естественного цикла, их тесной взаимосвязи, а также доказательство того, что организм – сложная система, работа которой основана в том числе и на химико-биологических процессах….

01 11 2021 3:29:30

Занятие «Слет грызунов – парад достоинств»

Диалоговое общение; использование на занятии дидактического материала; участие в изложении материала детей помогут активному освоению нового материала и ответу, на основании изученного, на вопрос » Зачем учить биологию и экологию». …

01 11 2021 0:30:52

Жвачные животные. Особенности строения пищеварительной системы

Для захвата листьев, травы, других зеленых растений жвачные используют губы, язык, зубы. На верхней челюсти нет резцов, но она оснащена жестким мозолистым валиком, коренные зубы на поверхности имеют лунку, такое строение позволяет активно поглощать и перетирать растительную еду….

01 11 2021 19:58:42

Урок-презентация «Селекция микроорганизмов. Биотехнология»

Предлагаемый урок по общей биологии разработан для учащихся 10-го профильного класса и направлен на активацию познавательной деятельности. К каждому этапу урока подобран интересный материал и демонстрируются кинофрагменты из диска » Биотехнология». …

01 11 2021 20:35:28

Разработка урока «Развитие жизни на Земле в архейскую и протерозойскую эры. Жизнь в водной среде»

На уроке у учащихся формируется система знаний об условиях возникновения жизни на нашей планете естественным путем; об основных ароморфозах у одноклеточных и многоклеточных организмов в архейскую, протерозойскую эры. Ученики убеждаются в том, что ныне существующие группы животных и растений прошли длительный путь исторического развития и претерпели значительные изменения на этом пути. …

01 11 2021 1:55:40

Повторение и обобщение по теме «Класс пресмыкающиеся»

Урок повторяет, обобщает и систематизирует знания учащихся о строении, процессах жизнедеятельности, происхождении, многообразии и значении пресмыкающихся; формирует бережное отношение к представителям класса, развивает мышление в решении проблемных задач….

01 11 2021 1:26:16

Урок по теме «Лягушка – типичный представитель класса земноводных»

Цель урока: формирование знаний об особенностях внешнего и внутреннего строения земноводных как первых наземных организмов, но не порвавших связь с водной средой обитания; об особенностях размножения; о значении земноводных в природе и жизни человека и необходимости их охраны….

01 11 2021 22:38:13

Урок биологии по теме «Внутреннее строение стебля». 6-й класс

Урок проводится в разделе изучения темы « Стебель». За неделю до урока детям дается домашняя лабораторная работа « Проведение питательных веществ по растению». На уроке проводится 10-минутная лабораторная работа « Внутреннее строение стебля липы». На уроке опрос проводится в виде игры «блиц-опрос», заранее готовятся вопросы к игре….

01 11 2021 23:30:14

Личностно-ориентированный урок биологии: Погружение в океан знаний под названием «Лист»

Урок разработан в рамках личностно-ориентированного подхода к обучению биологии. На уроке используются различные приёмы для сохранения здоровья учащихся: психологический настрой на урок путём включения в ролевую игру, которая способствует повышению учебной мотивации. Приём дифференциации заданий позволяет каждому выбрать учебные задания в соответствии с индивидуальными способностями….

01 11 2021 21:15:15

Обобщение и систематизация знаний как основа развития личности школьника

Основной задачей современной общеобразовательной школы является подведение выпускников к обоснованному выбору будущей профессии, который базируется на системе обобщенных знаний по предметам школьной программы. Это дает выпускнику возможность определить свою профильную подготовку, продолжить образование и получить профессию, в которой он будет успешен….

01 11 2021 3:22:11

Воздушная одежда Земли

Природоведение – это основа для дальнейшего изучения естественных наук. На уроках я уделяю внимание раскрытию способов познания природы человеком, для этого применяю различные методы, приемы активизации учебной деятельности учащихся, такие как наблюдения, проведение несложных опытов, умение самостоятельно искать ответы на проблемные вопросы, требующие практических знаний, основанных пусть еще небольшом, но уже каком-то жизненном опыте, уметь применить их в нужной теме. Здесь дана разработка урока в 5-м классе по теме « Воздушная одежда Земли». На этом уроке я показываю опыты, а дети сами делают выводы, доказывая свою правоту, почему так, а не по-другому; большая часть урока отводится самостоятельному поиску нужных ответов. Для более успешного усвоения материала подготовлена презентация, которая помогает обратить внимание на основное, иллюстрации помогают лучше запомнить, неслучайно говорят: » Лучше один раз увидеть, чем сто раз услышать». Презентация дает возможность и хорошо закрепить материал урока….

01 11 2021 9:57:16

Организм простейшего животного, особенности строения и жизнедеятельности. 7-й класс

Урок дает возможность обобщить, закрепить, систематизировать знания обучающихся по данной теме. Особый акцент ставится на собственную деятельность ученика, осознание и переработку знаний. Работая в группе с инструктивной карточкой-заданием, обучающиеся учатся распределять задания между собой, быстро отвечать, делать выводы….

01 11 2021 20:19:35

Удивительное рядом. Бабочки

Цели урока: с помощью маленького прекрасного насекомого — бабочки углубить знания по разным предметам; пробудить интерес детей и семьи к данной теме; создать условия для развития и саморазвития ребенка….

01 11 2021 16:17:56

Функция белков в клетке. Ферменты (10-й класс)

На уроке используются различные виды деятельности учащихся: изучение нового материала в виде лекции, практическое закрепление нового материала на лабораторной работе. Материал достаточно широко охватывает спектр знаний о биохимии ферментов и их роли в организме, имеет практическую направленность при обучении спортсменов училища. …

01 11 2021 7:55:56

Дыхательная система

Цель урока: закрепить полученные знания по теме и приемы оказания реанимации в различных жизненных ситуациях. Учащиеся знакомятся со строением, функциями и гигиеной дыхательной системы….

01 11 2021 21:12:27

Урок естествознания «Мхи»

Урок для 7-го класса специальной (коррекционной) школы VIII вида. Использован учебник « Естествознание». Цель урока: дать первоначальное представление о мхе, его строении; коррегировать устойчивое внимание и его переключение с одного вида деятельности на другой; прививать бережное отношение к флоре, зеленому миру….

01 11 2021 15:54:27

Достижения и основные направления современной селекции

Урок является заключительным в теме « Генетика и селекция» в 10-м классе. На уроке раскрывается краткая история биотехнологии, сущность биотехнологических процессов, перспективы развития современной селекции, для закрепления знаний проводится компьютерная лабораторная работа….

01 11 2021 12:23:28

Некоторые приемы мнемотехники

Проблема улучшения памяти была актуальна во все времена. Но особо остро она встала именно сейчас, во время развития компьютерных технологий, которые открыли для нас неограниченный доступ к информации. Чтобы сделать запоминание более быстрым и надежным, была изобретена мнемотехника — совокупность приемов и систем, служащих для улучшения хранения информации и воспроизведения ее из памяти….

01 11 2021 7:59:10

Использование крупнолуковичных цветочных культур на уроках биологии

В работе представлены вариативные разработки уроков по теме « Вегетативное размножение крупнолуковичных цветочных культур». Использованный теоретический и практический материал основан на опыте собственных исследований, осуществленных на агробиостанции Мичуринского государственного педагогического института….

01 11 2021 18:19:27

Методы изучения природы

Работа представляет собой урок природоведения в 5-м классе по теме » Методы изучения природы» по программе А. А. Плешакова и Н. И. Сонина. На данном уроке реализуется принцип деятельностного подхода, используются групповая и индивидуальная формы работы….

01 11 2021 17:30:25

Система экологического образования в МНОУ «Лицей» г. Кемерово

Привычку поступать по отношению к природе гуманно, следуя законам мировой морали, нужно воспитывать с самого раннего детства. В докладе отражен опыт работы преподавателей муниципального нетипового общеобразовательного учреждения » Лицей» по формированию системы экологического образования, охватывающую как урочную, так и внеурочную деятельность учащихся….

01 11 2021 2:18:57

Урок биологии в 8-м классе «Витамины»

При изучении данной темы используется работа в группах, что даёт возможность более полно использовать условия для восприятия теоретической и практической частей изучаемого материала. Цель урока – сформировать представление о значении витаминов и их роли в сохранении здоровья человека….

01 11 2021 20:15:46

Ботаника Биология

Ботаника, комплекс наук о растениях. Сформировалась ок. 2300 лет назад. Основоположником её считают древнегреческого учёного Теофраста, которого называют…

01 11 2021 4:12:12

Описание научно-методического опыта исследовательской деятельности учащихся в гимназии № 122 г. Казани

Проектная деятельность даст возможность выйти за рамки урока и представить изучаемую проблему с разных точек зрения. Ребята учатся основам научного эксперимента, определению задач работы, выбору методов изучения данной темы, обобщению полученных результатов, способам презентации исследования. О результативности проектной деятельности свидетельствует и успех в научной работе учеников, поступивших в высшие учебные заведения. Здоровье человека закладывается в детстве, что определяет важное значение исследования детской популяции. При этом здоровье рассматривается как способность детского организма в процессе роста и развития адаптироваться к условиям жизни. …

01 11 2021 13:10:18

Орнотологический КВН «День пернатых друзей» для учащихся 5—8-х классов

Конкурс позволяет закрепить, углубить знания учащихся, а также активизировать познавательную деятельность. Значительна роль данного конкурса для экологического обучения и привития экологической культуры, чувства сопереживания, гуманности к окружающим, в том числе птицам. …

01 11 2021 8:12:51

Какие структуры у амебы и парамеции общего с людьми?

Примеры многоклеточных протистов

Протисты — это группа организмов, которые имеют общие характеристики с растениями, животными и грибами, но они достаточно разные, чтобы заслужить статус отдельного типа организмов.Прочтите этот урок, чтобы узнать о редкой группе многоклеточных протистов.

Протисты: Дипломонады и Парабасалиды

В этом мире довольно много живых существ, так как же нам начать их разбирать? В этом уроке мы исследуем основную группу протистов, а также более конкретных дипломонад и парабазалидов.

Альвеоляты: динофлагелляты, апикомплексы и инфузории

Как одна из самых разнообразных таксономических групп, простейшие охватывают широкий спектр видов.В этом уроке мы рассмотрим группу, называемую альвеолами, и выясним, что делает каждый из трех типов уникальным.

Есть ли у протистов клеточные стенки?

Протисты — это группа организмов, которые не вписываются ни в одно из других царств.Поскольку протисты настолько разнообразны, у некоторых членов королевства есть черты, которых нет у других членов. В этом уроке будет описана функция клеточной стенки у протистов.

Протисты — чрезвычайно разнообразная группа эукариотических организмов.В этом уроке представлен обзор различных клеток протистов, включая их структуры, органеллы, формы и размеры.

Растительные протисты: характеристики и размножение

Протисты — это группа организмов, помещенных в одно царство, потому что они не совсем вписываются ни в одно из других царств эукариот.Протисты, похожие на растения, напоминают растения, но обладают уникальными характеристиками и возможностями размножения.

Плоские черви: типы и структура

Плоские черви принадлежат к типу Platyhelminthes, который включает планарий, сосальщиков и ленточных червей.Узнайте больше об этих животных, изучая содержание этого урока.

Sweat | Состав и функции

Узнайте о поте.Прочтите о значении пота и о том, что такое пот в организме. Разберитесь, из чего состоит пот, и выясните, являются ли моча и пот одним и тем же.

Кора головного мозга в растениях: функция и концепция

Слой коры головного мозга растений состоит из корневой и стеблевой ткани, которая помогает выживанию растений разными способами.Изучите различные слои стебля растения и изучите определение и концепцию коры головного мозга и ее функций.

Грибоподобные протисты: характеристики, типы и примеры

В этом уроке вы узнаете больше о невидимом мире микроскопических организмов, поговорив о наших дальних родственниках: грибовидных простейших, слизистых и водяных.Когда вы закончите, пройдите короткую викторину, чтобы проверить свое понимание.

Диффузия и осмос: Биологическая лаборатория

Диффузия и осмос происходят, когда молекулы воздуха или воды перемещаются из области с высокой концентрацией в область с низкой концентрацией.Узнайте, что такое диффузия и осмос, проверьте их дифференциальную проницаемость в биологической лаборатории и изучите концепции тоничности и водного потенциала.

Движение протистов спирогиры

Спирогиры составляют группу зеленых водорослей, которые можно увидеть просто плавающими на поверхности воды.Но, хотите верьте, хотите нет, но ученые узнали, что спирогира действительно может контролировать их движения. Этот урок исследует спирогиру, а также то, как они двигаются.

Урок простейших для детей: определение и факты

Крошечные, крошечные животные, невидимые невооруженным глазом, окружают нас повсюду.Они живут в воде и почве, а некоторые из них могут даже жить в нас! В этом уроке мы узнаем о некоторых из этих маленьких организмов, называемых простейшими.

Что такое митоз? — Определение, этапы и функции

Митоз — это тип деления клеток, при котором образуются две дочерние клетки с такими же хромосомами, что и родительская клетка.Узнайте, как определять митоз, просматривать интерфазные клетки, а затем определять стадии и функции митоза.

Что такое ячейка? | Изучайте науку в Scitable

Как упоминалось ранее, цитоплазма клетки содержит множество функциональных и структурных элементов. Эти элементы существуют в форме молекул и органелл — представьте их как инструменты, приспособления и внутренние помещения клетки. Основные классы внутриклеточных органических молекул включают нуклеиновые кислоты, белки, углеводы и липиды, все из которых необходимы для функций клетки.

Нуклеиновые кислоты — это молекулы, которые содержат и помогают выражать генетический код клетки. Существует два основных класса нуклеиновых кислот: дезоксирибонуклеиновая кислота (ДНК) и рибонуклеиновая кислота (РНК) . ДНК — это молекула, которая содержит всю информацию, необходимую для построения и поддержания клетки; РНК выполняет несколько функций, связанных с выражением информации, хранящейся в ДНК. Конечно, сами по себе нуклеиновые кислоты не отвечают за сохранение и экспрессию генетического материала: клетки также используют белки, чтобы помочь реплицировать геном и осуществить глубокие структурные изменения, лежащие в основе деления клеток .

Белки — это второй тип внутриклеточных органических молекул. Эти вещества состоят из цепочек более мелких молекул, называемых аминокислотами , и они выполняют множество функций в клетке, как , каталитические, и структурные. Например, белки, называемые ферментами , преобразуют клеточные молекулы (будь то белки, углеводы, липиды или нуклеиновые кислоты) в другие формы, которые могут помочь клетке удовлетворить ее энергетические потребности, построить поддерживающие структуры или выкачать отходы.

Углеводы , крахмалы и сахара в клетках, являются еще одним важным типом органических молекул. Простые углеводы используются для удовлетворения немедленных потребностей клетки в энергии, тогда как сложные углеводы служат в качестве внутриклеточных хранилищ энергии. Сложные углеводы также находятся на поверхности клетки, где они играют решающую роль в распознавании клеток.

Наконец, липиды, или молекулы жира являются компонентами клеточных мембран — как плазматической мембраны, так и различных внутриклеточных мембран.Они также участвуют в хранении энергии, а также в передаче сигналов внутри клеток и из кровотока внутрь клетки (рис. 2).

Некоторые клетки также имеют упорядоченное расположение молекул, называемых органеллами . Подобно комнатам в доме, эти структуры отделены от остального внутреннего пространства клетки собственной внутриклеточной мембраной. Органеллы содержат высокотехнологичное оборудование, необходимое для выполнения определенных работ внутри клетки. Одним из примеров является митохондрия , широко известная как «энергетическая установка» клетки, которая представляет собой органеллу, которая удерживает и поддерживает механизмы, участвующие в химических реакциях, производящих энергию (рис. 3).


Рисунок 2: Состав бактериальной клетки

Большая часть клетки состоит из воды (70%). Остальные 30% содержат различные пропорции структурных и функциональных молекул.


Рис. 3. Относительный масштаб биологических молекул и структур

Клетки могут варьироваться от 1 микрометра (мкм) до сотен микрометров в диаметре.Внутри клетки двойная спираль ДНК имеет ширину примерно 10 нанометров (нм), тогда как клеточная органелла, называемая ядром, которое включает эту ДНК, может быть примерно в 1000 раз больше (около 10 мкм). Посмотрите, как клетки сравниваются по относительной оси шкалы с другими молекулами, тканями и биологическими структурами (синяя стрелка внизу). Обратите внимание, что микрометр (мкм) также известен как микрон.


Выделение и идентификация свободноживущих амеб из водопроводной воды в Сивасе, Турция

Настоящая работа сосредоточена на местном исследовании свободноживущих амеб (FLA), которые вызывают оппортунистические и неопортунистические инфекции у людей.Определение распространенности FLA в водных источниках может пролить свет на необходимость предотвращения заболеваний, связанных с FLA. Всего было отобрано 150 проб водопроводной воды из шести районов провинции Сивас. Образцы фильтровали и высевали на непитательный агар, содержащий Escherichia coli , спред. Тридцать три (22%) из 150 образцов оказались положительными на FLA. FLA идентифицировали по морфологии и с помощью ПЦР с использованием гена 18S рДНК. Морфологический анализ и частичное секвенирование гена 18S рДНК выявили присутствие трех разных видов: Acanthamoeba castellanii , Acanthamoeba polyphaga и Hartmannella vermiformis . Naegleria fowleri , Balamuthia mandrillaris или Sappinia sp. не был изолирован во время исследования. Было обнаружено, что все типы последовательностей A. castellanii и A. polyphaga относятся к генотипу Т4, который содержит большинство патогенных штаммов Acanthamoeba . Результаты показали наличие и распространение видов FLA в водопроводной воде в этих населенных пунктах Сиваса, Турция. Кроме того, наличие термостойкого Acanthamoeba генотипа Т4 в водопроводной воде в регионе должно быть принято во внимание с точки зрения риска для здоровья.

1. Введение

Свободноживущие амебы (FLA), вездесущие и широко распространенные простейшие, питаются бактериями, водорослями, грибами и небольшими органическими частицами и могут адаптироваться к окружающей среде [1]. Их можно найти в пыли, воздухе, морской воде, стоматологических установках, сточных водах, растворах для промывания глаз, контактных линзах и диализных установках, и их особенно много в почве и воде [2, 3]. Среди них только четыре рода, включая Acanthamoeba , Naegleria , Balamuthia и Sappinia , вызывают оппортунистические и неоппортунистические инфекции у людей и животных, но инфекции обычно не регистрируются, за исключением Acanthamoeba keratitis . сообщается о более чем 1–2 случаях на миллион пользователей контактных линз в США ежегодно [4–6]. Acanthamoeba spp. и Balamuthia mandrillaris вызывают гранулематозный амебный энцефалит (GAE), а Naegleria fowleri вызывают первичный амебный менингоэнцефалит (PAM). И GAE, и PAM являются инфекциями центральной нервной системы. Некоторые виды Acanthamoeba spp., Обычно Acanthamoeba castellanii , вызывают амебикератит (AK), инфекцию роговицы, угрожающую зрению. У человека Acanthamoeba spp. также может поражать кожу и легкие [3, 7]. Hartmannella spp. проникают в ткани животных и были обнаружены в слизистой оболочке носа человека, бронхиальной системе собак и кишечнике индеек [8]. Sappinia diploidea были зарегистрированы только один раз в результате инфекции головного мозга у здорового человека [9]. Эта амеба была позже идентифицирована как Sappinia pedata с помощью тестов ПЦР в реальном времени, основанных на последовательностях гена 18S рРНК [10].

Присутствие FLA в водопроводной воде может представлять риск для здоровья как для лиц с ослабленным иммунитетом, так и для иммунокомпетентных [11], и они устойчивы к экстремальным условиям температуры, pH и воздействию различных химикатов [2, 5].Помимо своей патогенности, FLA служат хозяевами для большого количества патогенных бактерий и вирусов для человека, включая Legionella spp., Vibrio cholerae , Burkholderia cepacia, Listeria monocytogenes, Escherichia coli O157, Mycobacterium 123. Coxsackievirus, Adenovirus и Echovirus [2, 5, 11]. Кроме того, FLA может увеличивать вирулентность некоторых бактерий, называемых устойчивыми к амебе микроорганизмами (ARM), включая Mycobacterium spp., Pseudomonas aeruginosa , Legionella spp., Cryptococcus neoformans и Histoplasma capsulatum [11].

Сообщается об увеличении числа внутримозговых инфекций, вызванных FLA, в США и во всем мире [6].

FLA-инфекции человека задокументированы [12–14], но в литературе имеется ограниченная информация, касающаяся FLA из проб окружающей среды в Турции [15–17]. Поэтому целью данного исследования является выделение FLA из проб водопроводной воды, собранных в различных районах провинции Сивас, с использованием морфологических и молекулярных методов, чтобы внести свой вклад в изучение их экологии и выявить любые потенциальные риски для здоровья.

2. Объекты и методы
2.1. Место проведения исследования, отбор проб, выделение и идентификация амеб и выделение ДНК

В период с марта по август 2011 г. было собрано 150 проб водопроводной воды в районах Дивриги, Кангал, Сушехри, Улаш, Гёлова и Гемерек провинции Сивас. расположен в центральном регионе Анатолии Турции. Общая площадь территории провинции Сивас составляет 28500 км 2 , а площадь исследования составляет около 10000 км 2 (Рисунок 1).Сивас расположен на стыке разных регионов и отражает типичный климат различных регионов Турции. Таким образом, исследование распространенности в регионе с переходной экономикой, таком как Сивас, может отражать общее распределение FLA в Турции.


Все образцы (кроме двух из них, см. Таблицу 2) в этом исследовании были хлорированы городскими властями на заводе по производству питьевой воды в соответствии с критериями Всемирной организации здравоохранения (0,2–0,7 частей на миллион).

Всего было собрано 500 мл пробы воды из каждого водопроводного крана в стерильном пластиковом контейнере из разных деревень и районов.Затем их немедленно перевели в лабораторию. FLA выделяли из образцов, как описано ранее [7, 18]. Вкратце, образцы воды фильтровали через мембранный фильтр из нитрата целлюлозы с размером пор 0,45 мкм (диаметр 47 мм) под вакуумом. Мембранные фильтры для каждого образца воды соскребали, и собранные материалы помещали в 15 мл стерильных закрывающих пробирок, содержащих 10 мл фосфатно-солевого буфера (PBS). Пробирки инкубировали при комнатной температуре в течение ночи, а затем центрифугировали в течение десяти минут при 1500 об / мин для сбора частиц на фильтрах.После центрифугирования раствор супернатанта сливали, а осадок инокулировали на чашки с 1,5% непитательным агаром (NNA). Плотную суспензию инактивированной нагреванием Escherichia coli , приготовленную в солевом растворе Пейджа, высевали на планшеты с NNA для выращивания FLA. После инокуляции образцов все планшеты инкубировали при 30 ° C и ежедневно исследовали на наличие FLA в течение 10 дней с использованием светового микроскопа (100x). После того, как наблюдался рост, кусок NNA, содержащий амебы, вырезали, чтобы засеять свежую чашку NNA для субкультивирования, и инкубировали до тех пор, пока трофозоиты не выросли.Затем трофозоиты соскребали для выделения геномной ДНК (QIAmp DNA Mini Kit, QIAGEN).

Амебы были выделены и идентифицированы по морфологическим признакам, а также с помощью анализа последовательности на основе ПЦР. Основной список морфотипов Смирнова и Гудкова был использован для идентификации амеб [19]. Acanthamoeba был идентифицирован как по акантоподиям в форме трофозоитов, так и по двухслойным многоугольным стенкам в форме цист (рис. 2 (а)). Hartmannella был идентифицирован по гладкой сферической форме (рис. 2 (b)) [16, 20].Тест на устойчивость к температуре был также выполнен для Acanthamoeba : три набора планшетов для субкультур (NNA- E. coli ) для каждого образца инкубировали при 37, 42 и 52 ° C соответственно. Все чашки ежедневно проверяли на рост амеб с помощью фазово-контрастной микроскопии в течение семи дней [21]. Когда был выделен штамм FLA, для идентификации N. fowleri был применен тест трансформации жгутиков [20]. Все штаммы FLA были перенесены в свежий NNA- E.coli каждый месяц для проверки их жизнеспособности, и каждый из них использовался в экспериментах.

2.2. Использовали ПЦР-амплификацию, секвенирование, бласт-поиск секвенированных ампликонов и кластерный анализ амеб

Acanthamoeba, N. fowleri, B. mandrillaris и Sappinia , специфичных для рода пар праймеров вместе с общими праймерами, специфичными для амеб (таблица 1). в молекулярном обнаружении видов амеб [7, 10, 22–24]. Пятьдесят мкл смеси для ПЦР содержали 1 нг ДНК, 5 мкл 10x Taq-буфера, 5 мкл 2 мМ dNTP, 4 мкл 25 мМ MgCl 2 , 0.5 мкл 100 мМ праймера, 0,5 мкл ДНК-полимеразы Taq. Условиями термоциклирования были начальная инкубация при 94 ° C в течение 7 минут и 45 циклов при 94 ° C в течение 60 секунд (95 ° C для Acanthamoeba ), X ° C в течение 60 секунд и 72 ° C в течение 60 секунд с конечное удлинение 72 ° C в течение 10 мин (X = 55 ° C для Naegleria , Sappina и Balamuthia ; 60 ° C для Acanthamoeba и 65 ° C для обычных праймеров). Реакции ПЦР проводили для амплификации последовательностей 18S рДНК. Эти праймеры давали фрагменты размером 750–1000 п.н.Ампликоны ПЦР разделяли в 1% агарозном геле (данные не показаны, но доступны по запросу). Размеры ампликонов оценивали с помощью лестницы ДНК. Ампликоны очищали в геле перед секвенированием. Секвенирование было однонаправленным (5-GTCAGAGGTGAAATTCTTGG-3 ‘). Поиск нуклеотидного сходства был выполнен с помощью бласт-поиска (основной инструмент поиска локального выравнивания) секвенированных ампликонов против видов амеб. Acanthamoeba был недавно классифицирован на генотипы на основании нуклеотидного секвенирования 18S рибосомной РНК [25, 26].Регистрационные номера этих видов в GenBank приведены в таблице 2. Морфологические наблюдения и секвенирование выявили три различных вида: A. castellanii, Hartmannella vermiformis, и A. polyphaga .

Обратный праймер Ссылка

Виды Прямой праймер

Общий для FLA- CGCGGTAATTCCAGCTCCAATAGC CAGGTTAAGGTCTCGTTCGTTAAC Цветкова и др., 2004 [7]
Acanthamoeba spp . GGCCCAGATCGTTTACCGTG TCTCACAAGCTGCTAGGGAGTCA Шредер и др., 2001 [22]
Н. fowleri CAAACACCGTTATGACAGGG CTGGTTTCCCTCACCTTACG Шильд и др., 2007 [23]
Б . mandrillaris CGCATGTATGAAGAAGACCA TTACCTATATAATTGTCGATACCA Booton et al., 2003 [24]
Sappinia TCT GGT CGC AAG GCT GAA AC GCA CCA CCA CCC TTG AAA TC Qvarnstrom et al., 2009 [10]
FLA: Свободноживущие амебы.
9026 902 artmannella vermiformis 42 0260 902 902 902 902 902 902 902 902 902 Acanttellba 902 902 902 902 902 902 902 902

S Acanthamoeba polyphaga 261

Идентифицированные виды Генотип Банк генов исх. нет. Источник водопроводной воды

1 Acanthamoeba castellanii T4 U07403 Divriğimo 902 902 902 902 902 902 902 902 902 902 902 602 902 902 Деревня Кангал
3 Hartmannella vermiformis AF426157 Деревня Сушехри
4 2 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 Hartmannella vermiformis AF426157 Деревня Кангал
6 Hartmannella vermiformis AF426157 AF426157 AF426157 центр города Кангал *
8 Hartmannella vermiformis деревня AF426157 Сушехри
9 Hartmannella vermiformis AF426157 Сушехри село
10 Hartmannella vermiformis деревни AF426157 Кангал
11 Hartmannella vermiformis деревни AF426157 Сушехри
12 Hartmannella vermiformis AF426157 Деревня Диврини
13 Acanthamoeba castellanii T4 Деревня K0265 U0 261
14 Hartmannella vermiformis деревни AF426157 Ulas
15 Hartmannella vermiformis деревни AF426157 Сушехри
16 Hartmannella vermiformis AF426157 Дивригите село
17 Hartmannella vermiformis деревни AF426157 Golova
18 Hartmannella vermiformis AF426157 села Дивригите
19 Acanthamoeba castellanii T4 U07413 Деревня Кангал
20 Hartmannella vermiformis 9 село Кангал **
21 Acanthamoeba castellanii T4 U07413 село Кангал
22 2 2
23 Hartmannella vermiformis деревни AF426157 Сушехри
24 Hartmannella vermiformis AF426157 ulaş медицинского центра
25 Hartmannella vermiformis AF426157 Поселок Гемерек
26 Hartmannella vermiformis AF426157 Деревня Кангал65
AF426157 Kangal деревня
28 Hartmannella vermiformis деревни AF426157 Сушехри
29 Hartmannella vermiformis AF426157 Ulaş деревня
30 Acanthamoeba castellanii T4 U07413 Деревня Кангал
31 Hartmann603 2 2
T4 U07407 Деревня Улаш
33 Acanthamoeba castellanii T4
Родниковая вода.
** Фонтанная вода.

Кластерный анализ был выполнен для FLA с использованием последней версии программного обеспечения MEGA 5.05 [27]. Филогенетическая конструкция была получена с использованием последовательностей гена 18S рРНК и номеров доступа последовательностей гена 18S рДНК рода амеб, перечисленных в таблице 2. Они были выровнены с соответствующими последовательностями из 33 эталонных изолятов Acanthamoeba , и дерево соседних соединений было получено с использованием MEGA 5.05. (Рисунок 3) [27].


3. Результаты

FLA были обнаружены в 33 (22%) из 150 проб воды в шести районах Сиваса. Все изоляты Hartmannella были идентифицированы как H. vermiformis и, за исключением одного изолята, который был идентифицирован как A. polyphaga , все изоляты Acanthamoeba были идентифицированы как A. castellanii . Ни в одном из образцов не было ни одного представителя любого из трех других родов FLA, имеющих клиническое значение, Balamuthia, Naegleria и Sappinia, (таблица 2).Было замечено, что все изоляты Acanthamoeba были способны к росту при всех температурах инкубации, и они росли легко и быстро при инкубации 37 ° C, но трофозоиты амеб росли медленнее при 42 ° C или 52 ° C инкубации. После двух дней инкубации соответствующие изоляты Acanthamoeba оставались живы при 42 ° C (номера образцов 2, 13, 19, 27, 30, 32 и 33) и при 52 ° C (номера образцов 2, 13, 27). , 30, 32 и 33). Тест на трансформацию жгутиков оказался отрицательным для всех 33 изолятов.

Морфологическая идентификация амеб выявила трофозоиты Acanthamoeba и Hartmannella . Штаммы Acanthamoeba принадлежат к генотипу Т4, что подтверждается парой специфичных для рода праймеров (Таблица 1).

Основной целью настоящего исследования было применение и оценка молекулярных методов распознавания FLA наряду с классическим методом микроскопического определения. Мы использовали праймеры для ПЦР для диагностики видов FLA, используя общий набор праймеров и четыре набора праймеров, специфичных для рода (таблица 1).В этом исследовании изоляты FLA сравнивали с GenBank и эталонными штаммами (таблица 2) для определения вида. Длина ампликонов для ПЦР варьировала от 500 до 1000 пар оснований.

Изолятов Acanthamoeba дополнительно исследовали филогенетическим анализом путем сравнения секвенированных ампликонов со штаммами Acanthamoeba . Это включало все репрезентативные последовательности, доступные в GenBank. Все изоляты Acanthamoeba были сгруппированы в группу типа последовательности Т4.

Поиск гомологии выполняли с помощью BLAST от NCBI.Выведенные последовательности были выровнены с помощью ClustalW с последовательностями FLA, а затем филогенетическое дерево было отображено с помощью анализа объединения соседей, проведенного с помощью MEGA (рис. 3). Все последовательности показали 100% сходство, за исключением образца номер 2 (99%) с номерами доступа, приведенными на рисунке 3. В филогенетическом дереве видов Acanthamoeba и Hartmannella сгруппированы в разные ветви, но последовательности одного и того же рода сгруппированы вместе в одну группу. ветвь. Это показывает их генетическое сходство в определенной степени и соответствие с идентификацией изолированных образцов.

Анализ дерева соседних генов идентифицирует отдельные штаммы изолятов, полученных в этом исследовании, как показано ссылочными номерами, приведенными в таблице 2. Филогенетический анализ показал, что изолятов Acanthamoeba были сгруппированы по патогенному генотипу Т4 и наиболее близки к ссылочному номеру U07413. Однако два изолята Acanthamoeba относятся к ссылочным номерам U7413 и U07407. Точно так же изоляты Hartmannella относятся к справочному номеру AF426157.

Филогенетический анализ подтверждает клинически значимые амфизоидные амебы в водопроводной воде, которые могут представлять опасность для здоровья людей.

4. Обсуждение

FLA были распространены по всему миру, и состав этих видов в определенных местах зависит от окружающей среды. Кроме того, распространение видов FLA зависит от их устойчивости к выживанию в неблагоприятных условиях. Следовательно, экологическое значение FLA должно быть адекватно изучено для предотвращения смертельных заболеваний человека.В данном комплексном исследовании водные амебы были изолированы в различных районах провинции Сивас. Мы обнаружили FLA почти в одном из пяти источников воды в районах Сиваса. Результаты показали, что Acanthamoeba и Hartmannella имеют более высокое распределение в образцах по сравнению с другими FLA. Хотя были разработаны специфические праймеры, мы не выделили ни одного из N. fowleri, B. mandrillaris , и Sappinia sp. во время учебы. Это может быть связано с меньшей распространенностью таких FLA в окружающей среде.Наши результаты согласуются с исследованием из Болгарии [7]. Эта болгарская исследовательская группа определила Acanthamoeba и Hartmannella в больших количествах в пробах воды и почвы по сравнению с другими видами в Болгарии. Согласно исследованиям [28, 29], высокая распространенность вышеуказанного FLA в среде обитания человека наблюдалась в экологических пресных водах нескольких стран.

Acanthamoebae были ранее изолированы из бутилированной питьевой воды, водопроводной воды, почвы и пыли в провинциях Бурдур и Стамбул в Турции [15].Более того, как Acanthamoebae , так и Naegleria также были изолированы из образцов почвы и термальных вод в нашем регионе [16]. Однако в этом исследовании амеб не было идентифицировано ниже уровня рода. В нашем исследовании, за исключением Naegleria , мы также показали присутствие Acanthamoeba в том же регионе и идентифицировали эти виды. Acanthamoeba изолятов, принадлежащих к генотипам T2, T3, T4 и T7 из Анкары [17] и генотипам T4 и T9 из провинции Айдын [13], были обнаружены в пробах окружающей среды в Турции.

Насколько нам известно, присутствие FLA в окружающей среде не означает фактора риска заболевания. Однако многие виды Acanthamoeba потенциально патогенны для животных и человека. A. castellanii, A. polyphaga и A. culbertsoni являются наиболее распространенными видами, заражающими людей [30, 31]. Acanthamoeba spp. являются основной причиной АК, связанной с контактными линзами [2, 3], хотя случаи, связанные с Hartmannella sp.также описаны [32]. H. vermiformis был предложен как причина АК, но это все еще обсуждается другими исследователями [33]. В исследовании, проведенном в провинции Айдын, в западной части Турции, был зарегистрирован случай АК, вызванный штаммом Acanthamoeba генотипа T4 , который, возможно, связан с источником водопроводной воды [13]. Другой генотип, штамм T4 Acanthamoeba , также был зарегистрирован в случае АК в провинции Измир, соседней провинции Айдын. Считается, что водопроводная вода является наиболее важным источником АК, вызываемого генотипом Т4 Acanthamoeba [7], и во всем мире наиболее важные штаммы, вызывающие АК, связаны с генотипом Т4 [34, 35].

Acanthamoeba может выдерживать экстремальные температуры и, таким образом, становится морозоустойчивым, A. polyphaga может выживать при температуре ниже 4 ° C. Некоторые штаммы Hartmannella могут выдерживать температуру до 48 ° C [11, 36]. Поскольку провинция Сивас является местом с экстремально высокими и холодными температурами в течение года, мы делаем вывод, что определенные виды FLA устойчивы к экологическим условиям. По сообщениям, диапазон температур воздуха между зимой и летом составлял от -34,6 до 40 ° C в период с 1972 по 2011 год в Сивасе (Государственная метеорологическая служба Турции, http: // www.dmi.gov.tr). Помимо температурных условий окружающей среды, несколько других факторов, таких как структура кисты и доступность поверхности организма, изменения pH и изменения осмолярности в воде, также определяют продолжительность жизни FLA [37].

Acanthamoeba spp. и Hartmannella spp. могут содержать патогенные микроорганизмы, что указывает на важность этих амеб для здоровья населения. Acanthamoeba генотип T4 и H. vermiformis могут быть инфицированы естественным путем патогенными ARM. Acanthamoeba генотип Т4 может быть инфицирован Legionella sp. и Neochlamydia sp., тогда как H. vermiformis могут быть инфицированы Neochlamydia sp. и Legionella donaldsonii [37]. FLA может способствовать росту и транспортировке болезнетворных микроорганизмов, передающихся через воду. Следовательно, они используются патогенными вирусами ARM для распространения в системах питьевой воды. У нас есть ограниченные данные о хозяине FLA в питьевой воде. Ранее сообщалось, что уровень заражения FLA от ARM в системе питьевой воды составлял 16% [5].Вероятно, что еще предстоит определить несколько других FLA, инфицированных неидентифицированными патогенными ARM.

Интересно, что обнаружение FLA выявило присутствие нескольких родов FLA, а именно Acanthamoeba , Naegleria и Hartmannella, на разных этапах очистки воды на установках для очистки питьевой воды [38, 39]. Кроме того, Hartmannella spp. сообщается, что они устойчивы к дезинфекции на очистных сооружениях [38, 39]. Acanthamoeba spp.могут противостоять очистке воды для дезинфекции питьевой воды [28]. Эти данные согласуются с нашими выводами, поскольку 24 из 33 обнаруженных FLA были H. vermiformis , а 9 из 33 обнаруженных FLA были Acanthamoeba spp. (Таблица 2). Еще одна причина заключается в том, что высокая распространенность H. vermiformis в нашем регионе может быть связана с высоким уровнем активной биомассы и природного органического вещества [40], поскольку сельское хозяйство и животноводство распространены в провинции Сивас.

5.Выводы

Результаты показали присутствие A. castellanii, H. vermiformis, и A. polyphaga в водопроводной воде в районах Сиваса. Кроме того, для AK необходимо учитывать наличие термостойких генотипов Acanthamoeba T4 в этом регионе.

FLA недооценивались медицинским сообществом до тех пор, пока некоторые виды амеб не вызвали системные инфекции у лиц с ослабленным иммунитетом. Амебные заболевания трудно определить клинически, и пациент может страдать от задержки в лечении.Кроме того, такая задержка может привести к смертельным инфекциям и стать причиной смертельных случаев. Поэтому очень важно изучить связь между окружающей средой и инфекциями пациента. Индивидуальный анамнез, включая взаимодействие с амебной водой и вдыхание кист во время пыльной бури, может помочь врачу диагностировать инфекцию. Информация о предшествующей распространенности амеб в регионе может помочь врачам диагностировать и лечить здоровых людей или людей с ослабленным иммунитетом. Клиницисты могут извлечь пользу из представленных данных при лечении инфекций, связанных с амебами.Присутствие FLA может побудить к принятию мер предосторожности, а сообщения о распространении FLA могут помочь понять потенциальную угрозу для здоровья людей.

Данные, полученные в результате исследования, могут быть полезны для врачей и специалистов по окружающей среде в регионе и регионах по всему миру, которые имеют схожие экологические условия.

Конфликт интересов

Авторы заявляют об отсутствии конфликта интересов.

Вклад авторов

Ю. Тутар был главным исследователем и несет основную ответственность за статью.К. А. Чошкун и Л. Тутар проводили эксперименты. Н. Элалди и С. Озчелик координировали исследование. Написал газету Ю. Тутар.

Благодарность

Эта работа финансировалась за счет начального гранта Национальной академии наук Турции (TUBA-GEBIP).

Как гигантские вирусы заражают амебу — ScienceDaily

Клетки-хозяева, зараженные гигантскими вирусами, ведут себя уникальным образом. Чтобы глубже понять механизм заражения гигантскими вирусами, ученые разработали специальный алгоритм, который может отслеживать перемещение клеток-хозяев.Этот метод также можно использовать для изучения любых других типов клеток, таких как раковые клетки, нейроны и иммунные клетки, что может служить эффективным инструментом в области клеточной биологии.

Вирусы, вероятно, являются наиболее своеобразными «формами жизни» из известных нам, каждый из которых обладает уникальными характеристиками. Все вирусы объединяет то, что они атакуют «хозяйскую» клетку и захватывают ее механизмы, используя их для собственной репликации. Большой вирус, называемый «гигантским вирусом», имеет интересные способы атаковать организм-хозяин — амебу.Вирусологи уже некоторое время пытаются понять, что делает эти вирусы такими уникальными, но для их наблюдения требуются сложные методы. Метод, называемый фазово-контрастной микроскопией, обычно используется для изучения всех типов клеток, включая амебные клетки. Но этот метод в значительной степени зависит от изменений условий в ячейке и ее фона, и иногда это приводит к сбоям в создаваемом изображении — например, «ореол» (в котором ячейка окружена ярким светом) и « затенение »(в котором внутренняя часть ячейки и фон имеют одинаковую интенсивность).Вот почему, чтобы глубже понять, как именно гигантские вирусы инфицируют амебные клетки, необходимы более эффективные методы отслеживания клеток. Чуть ранее в этом месяце ученые из Токийского научного университета под руководством профессора Масахару Такемура сообщили об открытии двух новых видов пандоровируса и мимивируса — обоих семейств гигантских вирусов, заражающих амебы — на берегу реки в Японии. Профессор Такемура говорит, что постоянное открытие вирусов из почвы имеет решающее значение с точки зрения понимания экологии гигантских вирусов.

Что еще более важно, в новом исследовании, опубликованном в Frontiers in Microbiology , группа ученых из Токийского университета науки, снова во главе с профессором Такемура, попыталась понять поведение амебных клеток, инфицированных различными типами гигантских вирусов. . Для этого они разработали новый метод отслеживания клеток, который решает проблемы традиционных методов анализа. Профессор Такемура уточняет мотивацию исследования: «Наша цель состояла в том, чтобы понять, как гигантские вирусы заражают амеб в естественной среде и как это влияет на эволюцию эукариот.Для этого мы хотели разработать метод количественного определения зависящих от времени последовательных изменений числа клеток, размера, формы, направления и расстояния подвижности клеток ».

В своем исследовании профессор Такемура и его команда сосредоточили внимание на амебах, зараженных семейством гигантских вирусов, называемых «марсельлевирус». Чтобы понять поведение клеток-хозяев, инфицированных этим конкретным типом вируса, ученые разработали новый алгоритм, который может отслеживать отдельные амебные клетки в популяции амеб с помощью покадровых фазово-контрастных микроскопических изображений.Они назвали этот алгоритм «Алгоритм кинетического анализа на основе фазового контраста для амеб» или PKA3. Используя PKA3, ученые выявили новые интересные аспекты того, как амебы реагируют на гигантскую вирусную атаку. Например, они количественно показали, что гигантские инфицированные вирусом амебные клетки образуют агрегаты или «сгустки». Они пришли к выводу, что это может быть либо противовирусная стратегия хозяина, либо способ распространения вируса, что проливает свет на то, как происходит вирусная инфекция. Более того, им удалось обнаружить изменение количества клеток и появление амеб, инфицированных марсельлевирусом, намного быстрее, чем обычными методами.Интересно, что они также могли анализировать время, необходимое амебам, чтобы отреагировать на вирусную инфекцию, предоставляя полезную информацию о жизненном цикле амеб и вирусов и взаимосвязи между ними. Профессор Такемура говорит: «Наш алгоритм успешно визуализировал движение клеток на изображениях, полученных с помощью фазово-контрастной микроскопии, метода, широко используемого в клеточной биологии. Кроме того, он позволил количественно оценить различные параметры. Это исследование внесет большой вклад в демонстрацию амеба, зараженная гигантским вирусом.«

Помимо изучения гигантских вирусов, этот новый алгоритм можно использовать для различных других приложений, таких как изучение динамики раковых клеток, лимфоцитов, макрофагов и нейронов. В общем, он может выявить новые клеточные явления, точно отслеживая, как эти клетки мигрируют. В заключение профессор Такемура сказал: «Наш новый аналитический метод может быть применен ко всем клеткам, которые можно наблюдать с помощью фазово-контрастного микроскопа, и потенциально может быть применен в различных областях, включая клеточную биологию, медицину и биотехнологию.«

Действительно, такая техника, которая потенциально может облегчить исследования в области клеточной биологии, была очень нужна!

История Источник:

Материалы предоставлены Токийским научным университетом . Примечание. Содержимое можно редактировать по стилю и длине.

Произошла ошибка при настройке пользовательского файла cookie

Этот сайт использует файлы cookie для повышения производительности. Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


Настройка вашего браузера для приема файлов cookie

Существует множество причин, по которым cookie не может быть установлен правильно. Ниже приведены наиболее частые причины:

  • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки своего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
  • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, используйте кнопку «Назад» и примите файлы cookie.
  • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
  • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
  • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie. Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

Почему этому сайту требуются файлы cookie?

Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


Что сохраняется в файле cookie?

Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

Как правило, в файлах cookie может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

Схема парамеций и амеб и их функций

ПАРАМЕТРЫ

Paramecium широко распространен в пресноводных, солоноватых и морских средах и часто очень распространен в стоячих бассейнах и прудах.Поскольку некоторые виды легко культивируются и легко индуцируются для конъюгирования и деления, он широко используется в классных комнатах и ​​лабораториях для изучения биологических процессов.

Описание Paramecium

Парамеций — это одноклеточный (одноклеточный) эукариотический организм, обычно встречающийся в стоячей воде. Хотя очень маленький, иногда большой парамеций можно увидеть как крошечные пятнышки, мечущиеся в пробе воды. Парамеций может быть около 0,5 мм в длину. Виды Paramecium имеют размер от 50 до 330 мкм (0.От 0020 до 0,0130 дюйма) в длину. Клетки обычно имеют яйцевидную, удлиненную, форму стопы или сигару. Тело клетки окружено жесткой, но эластичной мембраной (пленкой), равномерно покрытой простыми ресничками, волосовидными органеллами, которые действуют как крошечные весла, перемещая организм в одном направлении. Пленка придает парамеции определенную форму, но она достаточно гибкая, чтобы допускать небольшие изменения формы. Почти все виды имеют близкорасположенные веретеновидные трихоцисты, глубоко внедренные в клеточную оболочку (кору), которая окружает организм.Обычно анальная пора (цитопрокт) располагается на вентральной поверхности, в задней половине клетки. У всех видов имеется глубокая оральная бороздка, идущая от передней части клетки до ее середины. Он покрыт незаметными ресничками, которые непрерывно бьются, втягивая пищу внутрь клетки. Парамеции живут в основном за счет гетеротрофии, питаясь бактериями и другими мелкими организмами.

Структура и функции частей парамеция

Pellicle — мембранное покрытие, которое защищает парамеций, как кожу
Реснички — волосковые придатки, которые помогают парамеции перемещать пищу в ротовую бороздку, а также отвечают за передвижение (движение)
Oral Groove — собирает и направляет пищу в рот клетки также попадает питательное вещество.
Cell Mouth — отверстие для еды
Anal Pore — удаляет отходы
Contractile Vacuole — сокращает и вытесняет лишнюю воду из клетки
Radiating Canals — пути к сократительной вакуоли
58 Cytoplasmular 9 жидкость, необходимая для содержания жизненно важных частей клеток
Trichocyst — используется для защиты
Gullet — образует пищевые вакуоли
Food Vacuole — карман для хранения пищевых продуктов.полость парамеция, отвечающая за пищеварение.
Макронуклеус — более крупное ядро, которое выполняет нормальные функции клетки.
Микронуклеус — меньшее ядро, которое отвечает за деление клетки.

Парамеций Репродукция

Paramecium демонстрируют как половое, так и бесполое размножение.

Бесполое размножение — Это наиболее распространенный вид размножения. Организм делится поперечно. Макронуклеус удлиняется и расщепляется.В идеальных условиях Paramecium может воспроизводиться бесполым путем два или три раза в день.

Половое размножение — Paramecium размножаются половым путем только в стрессовых условиях. Это происходит за счет агглютинации и слияния гамет. Два Paramecium соединяются вместе, и соответствующие им микроядра подвергаются мейозу. Три образовавшихся nuceli распадаются, четвертый подвергается митозу. Дочерние ядра сливаются, и клетки разделяются. Старое макронуклеус распадается и образуется новый.За этим процессом обычно следует бесполое размножение .

Механизм Paramecium

Парамеций плывет, ударяя реснички. Парамеций движется по спирали в воде по невидимой оси. Чтобы парамеций двигался назад, реснички просто толкаются вперед под углом. Если парамеций натыкается на твердый объект, реснички меняют направление и бьются вперед, заставляя парамеций двигаться назад. Парамеция слегка поворачивается и снова выходит вперед.Если он снова столкнется с твердым объектом, он будет повторять этот процесс до тех пор, пока не сможет пройти мимо объекта.

Paramecium Diet

Paramecium питаются микроорганизмами, такими как бактерии, водоросли и дрожжи. Парамеция использует свои реснички, чтобы подметать пищу вместе с небольшим количеством воды в ротовую полость клетки после того, как она попадает в ротовую бороздку. Пища проходит через рот клетки в пищевод. Когда пищи в ней достаточно, чтобы она достигла определенного размера, она отламывается и образует пищевую вакуоль.Пищевая вакуоль проходит через клетку сначала через задний конец. По мере продвижения ферменты из цитоплазмы попадают в вакуоль и переваривают ее. Затем переваренная пища попадает в цитоплазму, и вакуоль становится все меньше и меньше. Когда вакуоль достигает анальной поры, оставшиеся непереваренные отходы удаляются. Paramecium может выбрасывать трихоциты при обнаружении пищи, чтобы лучше захватить свою добычу. Эти трихоциты заполнены белками. Трихоцисты также можно использовать как метод самозащиты. Paramecium — гетеротрофы. Их обычная добыча — бактерии. Один организм способен съесть 5000 бактерий в день. Также известно, что они питаются дрожжами, водорослями и мелкими простейшими. Paramecium захватить свою жертву посредством фагоцитоза

AMOEBA

Амеба — это крошечный одноклеточный организм. Чтобы увидеть большинство амеб, вам понадобится микроскоп — самые большие имеют всего около 1 мм в диаметре. Амебы живут в пресной воде (например, в лужах и прудах), в соленой воде, во влажной почве и среди животных (включая людей).Есть много разных видов амеб. Название амеба происходит от греческого слова амоибе, что означает изменение. (Амеба иногда пишется как амеба.)

Описание амебы

Этот организм не имеет жесткой формы, но сделан из гибкого материала, который меняет форму по мере необходимости. Амеба состоит из протоплазмы, вязкого, прозрачного материала с клеточной мембраной, разделяющей эктоплазму и эндоплазму, или внешнюю и внутреннюю части клетки. Эндоплазма содержит ядро ​​клетки.

Амеба состоит из единственной каплевидной клетки, окруженной пористой клеточной мембраной. Амеба «дышит» с помощью этой мембраны — газообразный кислород из воды проходит к амебе через клеточную мембрану, а углекислый газ выходит через нее. Сложная желеобразная серия складчатых мембран, называемая цитоплазмой, заполняет большую часть клетки. Большое дискообразное ядро ​​внутри амебы контролирует рост и размножение амебы.

Структура и функции частей амебы

Цитоплазма — Цитоплазма дифференцируется на эктоплазму и эндоплазму.Эктоплазма образует внешний и относительно прочный слой, лежащий прямо под леммой о плазме. Это тонкий, прозрачный (негранулированный) и гиалиновый слой. Он утолщен в гиалиновый колпачок на продвигающемся конце на концах псевдоподий.

Плазма-лемма — Плазма-лемма — очень тонкая, нежная и эластичная клеточная мембрана амебы. Он состоит из двойного слоя липидных и белковых молекул. Эта мембрана избирательно проницаема и регулирует обмен воды, кислорода и углекислого газа между животным и окружающей средой.

Клеточная мембрана — тонкий слой белка и жира, окружающий амебу; он позволяет одним веществам проникать в клетку и блокирует другие вещества.
Сократительная вакуоль — Наружная часть эндоплазмы около заднего конца содержит прозрачную округлую и пульсирующую вакуоль, заполненную водянистой жидкостью. Это полость внутри амебы, которая выделяет лишнюю воду и отходы; отходы попадают на клеточную мембрану, а затем выводятся из амебы.
Пищевая вакуоль — полость внутри амебы, в которой пища переваривается (расщепляется для поглощения амебой).
Ядро — Ядро имеет прочную ядерную мембрану или ядерную оболочку и содержит прозрачное ахроматическое вещество с мельчайшими гранулами хроматина или хромидиями, равномерно распределенными по поверхности. Ядро — главная органелла амебы, расположенная в центре; он контролирует воспроизводство (он содержит хромосомы) и многие другие важные функции (включая питание и рост).
Pseudopodia — временные «ступни», которые амеба использует для передвижения и захвата пищи.

Диета амебы

Амеба использует свои псевдоподии , чтобы вытягиваться и дотянуться до пищи, окружая ее и втягивая обратно в остальную часть амебы . Основными компонентами рациона амебы являются бактерии и водоросли. Псевдоподия — один из наиболее важных аспектов амебы. Он помогает амебе двигаться, питаться и добираться до всего, что ей нужно.Псевдоподия буквально означает поддельная ступня, и эта ступня делает почти все, что нужно делать амебе. Это кровь амебы. Псевдоподии — это временные пальцевидные выступы с тупыми закругленными кончиками, которые постоянно выдаются или выводятся телом.

Размножение амебы

Размножение амеб в основном происходит бесполым путем, то есть путем бинарного деления, множественного деления и споруляции.

Binary Fission — В этом процессе все тело делится на две дочерние амебы путем митоза.Деление включает деление ядра (кариокинез) с последующим делением цитоплазмы (цитокинез). Дивизия проходит на выгодных условиях

Споруляция — В неблагоприятных условиях амеба размножается путем образования спор внутри. Он начинается с разрушения ядерной мембраны и выброса блоков хроматина в цитоплазму. Каждый блок хроматина приобретает ядерную мембрану и становится маленьким дочерним ядром. Новообразованные ядра окружаются цитоплазмой, образуя амебулы.

Множественное деление — При неблагоприятных условиях амеба делится множественным делением. Он удаляет свои псевдоподии, становится шаровидным и выделяет вокруг себя трехслойную кисту. Его ядро ​​претерпевает повторные митозные деления, образуя 500-600 дочерних ядер.

Чтобы получить дополнительные вопросы и пояснения к вашей работе, отправьте электронное письмо по адресу [email protected]

Чендлер Фултон помогает написать удивительную историю жизни амебы

Чендлер Фултон помогает написать удивительную историю жизни амебы

Одноклеточное чудо, Naegleria gruberi только что заполнило важную главу в книге жизни

18 марта 2010 года

Амеба
«Эй, у меня для тебя новости, дорогая!».. Я самая низкая форма жизни на земле! » произносит одну слизистую амебу другой, когда они отдыхают перед телевизором в классическом мультфильме Гэри Ларсона. Что ж, как оказалось, эта раздражительная амеба ошиблась.

Одноклеточная почвенная амеба, известная как Naegleria gruberi, обычная обитательница грязи, луж и пресноводных водоемов от Брандейса до Бора-Бора, от Антарктиды до Арктики, поразительно универсальна и эволюционировала для простейших. Этот маленький эукариот (организм с ядром и другими отделенными органеллами) ведет сложный образ жизни, который включает в себя ходьбу, плавание и даже превращение в твердую защитную кисту в неблагоприятных условиях окружающей среды.

Фактически, революционное исследование, опубликованное в качестве «Избранной статьи» в выпуске Cell от 5 марта двумя десятками ученых, в том числе заслуженным профессором биологии Брандейса Чендлером Фултоном, показывает, что у людей и Наглерии больше общего, чем считалось ранее. В ходе исследования ученые впервые секвенировали геном этого изящного организма, подняв завесу над нашей общей генетической историей и древним переходом от прокариот, включая бактерии, которые функционируют с их белками, просто плавающими в их клетках, к более развитым эукариотам. .

Клетка, претерпевающая
дифференцировку
и закругленная
до сферы с
двумя короткими жгутиками

До сих пор ученые в основном секвенировали одноклеточные организмы, которые либо ближе к нашему происхождению, такие как дрожжевые и слизистые плесени, либо являются паразитами, такими как лямблии, которые потеряли гены за долгие годы, освободившись от хозяев.Напротив, сравнение генома свободноживущей Naegleria с другими геномами, включая наш, выявляет общего общего предка 1,5 миллиарда лет назад и показывает, что эукариотическая жизнь уже была намного сложнее, чем предполагали ученые.

Для Фултона результаты исследования особенно отрадны, так как завершают полувековые нежные отношения с этими «маленькими парнями» и создают возможности для исследований на многие-многие годы. В начале шестидесятых Фултон, молодой амбициозный биолог из Брандейса, искал модельный организм, в котором можно было бы изучить дифференцировку клеток, чтобы лучше понять проблемы эмбрионального развития.

«Мне нужна была простая система, и я действительно занялся поиском», — говорит Фултон. «Я нашла Naegleria gruberi, которую мало изучили, но как только я начал работать с ней в лаборатории, я понял, что это идеальный организм для использования. Я искал что-то, что могло бы быстро превратиться из одной формы в совершенно другую, и этот парень мог это сделать. За полтора часа он может перейти от хождения с помощью псевдопод к обтекаемой клетке со жгутиками, которая плавает в 100 раз быстрее, чем могут ходить амебы », — говорит Фултон.

Жгутик

За десятилетия Фултон и его лаборатория сделали ряд важных открытий и опубликовали около сотни статей с использованием Наглерии. Среди достижений лаборатории разработаны стандартные условия выращивания амеб и изучения их дифференциации на жгутиконосцев. Фултон и его коллеги обнаружили, что центриольные структуры, образующиеся в основании жгутиков, возникают de novo; до этого ученые считали, что центриоли могут образовываться только рядом с родительской структурой.

После неожиданного открытия, что тубулины, используемые для сборки жгутиков, синтезируются во время дифференцировки и отличаются от тех, которые используются для деления клеток, Фултон предложил «гипотезу мультитубулина», которая повлияла на многие работы над цитоскелетом в 1980-х. Все эти исследования сделали Naegleria модельной системой для изучения клеточной дифференцировки и морфогенеза клеточных органелл, процесса, с помощью которого формируются клеточные компоненты.

Короче говоря, Фултон нашел амебу золотой жилой для научных исследований — создателем карьеры для него, а также для многих студентов, аспирантов и докторов наук, которые участвовали в этом исследовании, и других, которые пристально изучали простейшие в поисках ключей к разгадке. организация и развитие жизни.Для них маленькая амеба не разочаровала.

Чендлер Фултон
«Несмотря на всю нашу прошлую работу, анализ генома является одним из важнейших достижений моей карьеры. Это открытие вызвало огромный научный отклик, и это открытие повлияет на сотни научных работ », — говорит Фултон. «В конце концов, мы в Brandeis определили Naegleria gruberi как партнера по исследованиям».

Перенесемся на 50 лет после публикации исследования Cell, которое показало, что Naegleria содержит почти 16 000 генов, кодирующих белки, в то время как люди имеют 23 000 генов, кодирующих белок.Осознав эту информацию, ученым пришлось решить, какой из тысяч генов был биологически важен для дальнейшего изучения. Фултон включился в анализ после того, как геном был аннотирован. В качестве примера он говорит, что удивительное открытие генов сексуальности представляет особый интерес, поскольку известно, что этот организм размножается только бесполым путем — аккуратным темпом раз в полтора часа.

Эта сокровищница генов движет и многими другими талантами Наэглерии.Например, амеба предпочитает лениво возиться с использованием псевдопод для охоты на бактерии. Но если ходьба (Фултон настаивает, что амеба не «сочится») не приводит к получению достаточного количества пищи, амеба быстро превращается в жгутиков. Обладая двумя хлыстоподобными хвостами, которые делают его одноклеточным эквивалентом олимпийского пловца, он может уплыть в поисках большего количества бактерий, прежде чем вернуться к капюшону амебы, чтобы поесть и размножаться.

Наконец, если условия становятся действительно неблагоприятными, Naegleria просто впадает в спячку, превращаясь в цисту покоя с стенками, которая может выживать в неблагоприятных условиях, пока сырость, тепло и еда не вернут хорошие времена, и амеба снова не станет слизистой.Амебы могут расти, «дыша» воздухом, используя кислород для получения энергии, как это делаем мы, или в иле на дне пруда, где им приходится вырабатывать энергию без кислорода.

Геном был секвенирован Объединенным институтом генома Министерства энергетики и аннотирован командой из Калифорнийского университета в Беркли, а затем проанализирован группой, в которую также входили исследователи из Англии, Канады и Брандейса. Исследователи из Беркли сравнили геном Naegleria с геномами 16 других эукариот, от людей и грибов до зеленых растений и других одноклеточных эукариот, и впервые выявили набор из не менее 4000 генов, которые, вероятно, были частью первых, наиболее первобытный предковый эукариот.

«Мы знаем, что линия предков, которая привела к появлению людей, отделилась от линии, которая произвела Naegleria в эволюции около 1,5 миллиарда лет назад, когда эукариоты только зарождались», — говорит Фултон. «Мы разошлись, и никто не знает, как выглядел наш общий предок, первый эукариот».

Но сравнение геномов человека и амебы дало очень неожиданные результаты.

«Наэглерии и люди настолько далеки друг от друга, насколько это возможно для современных эукариот, но когда мы сравниваем гены и обнаруживаем, что у Наглерии и людей есть генетический набор инструментов для спаривания и размножения, это говорит нам о том, что у нашего общего предка, вероятно, был этот инструмент. kit тоже, — говорит Фултон, добавляя, — такие выводы означают, что у тех древних предков, которые играли в слизи с низким содержанием кислорода, были многие из тех же генов, что и у нас сегодня.

Гены Naegleria также проливают свет на то, как клетки движутся, сигнализируют друг другу и усваивают питательные вещества.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *